Labshake search
Citations for Thermo Fisher :
9701 - 9750 of 10000+ citations for Mouse Anti Hepatitis C Virus Core Protein Antibody 1862 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... a fluorophore-conjugated primary antibody (mouse ZO1-1A12 IgG1 AlexaFluor 488; Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... and then incubated with primary antibodies against mouse SPRR1A (Thermo Fisher PA5-26062), mouse CD36 (R&D AF2519) ...
-
bioRxiv - Genetics 2021Quote: ... The secondary antibody Alexa Fluor 555 donkey α-mouse (1:1000, Invitrogen #A31570) was added with DAPI (1 µg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... rat and mouse IgG were used as secondary antibodies (Molecular Probes, Eugene, OR).
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies (α-mouse Alexa Fluor 568 Molecular Probes Cat# A-11004, RRID:AB_2534072) at 1:300 dilution were incubated for one hour at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated with Troponin T antibody (Thermo Fisher MS295, mouse monoclonal 1:100) overnight at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... 1µg of mouse 1gG2A monoclonal GFP antibody (Thermo Fisher Scientific, [E36] A-11120) was crosslinked to 50μl of Protein A Dynabeads→ (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... and antibody-coated magnetic beads (Rabbit and Pan Mouse IgG beads, Life Technologies). Samples prepared for ChIPs were cross-linked in 1% formaldehyde overnight on ice ...
-
bioRxiv - Biochemistry 2021Quote: ... employing a mouse primary monoclonal antibody against His6-tag (MA1-4806, Invitrogen, USA) and a horseradish peroxidase-conjugated goat anti-mouse antibody (A2554 ...
-
bioRxiv - Cancer Biology 2019Quote: ... or mouse monoclonal antibody against HK-2 (1:100; Thermo Fisher, MA5-15679). After repeated washes ...
-
bioRxiv - Microbiology 2020Quote: ... Flag and HA were detected with mouse monoclonal antibodies (Invitrogen, Carlsbad, CA, USA).
-
bioRxiv - Biophysics 2020Quote: ... 647 and 680-conjugated goat antibodies against mouse IgG were from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2022Quote: The following antibodies were used in this study: mouse α-myc (Invitrogen, 9E10); rabbit α-Arf1 (from Todd Graham ...
-
bioRxiv - Bioengineering 2022Quote: ... mouse monoclonal VE-cadherin Alexa Fluor 488-conjugated antibody (Fisher Scientific; 1:100); mouse monoclonal collagen IV (1042 ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies used were mouse monoclonal α-V5 (Invitrogen R960-25; 1:2’000) and rabbit monoclonal α-hexokinase (US biologicals ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were as follows: HuC/D (mouse, ThermoFisher A21272, 1:200), Cherry (goat ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: Claudin-5 (mouse, clone 4C3C2, ThermoFisher cat# 35-2500, 1:100), Iba1 (goat polyclonal ...
-
Precision genetic cellular models identify therapies protective against endoplasmic reticulum stressbioRxiv - Neuroscience 2020Quote: ... or mouse IgG isotype control antibody (ThermoFisher Scientific, cat. MA5-14453, 1:500) for 1 hr at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:6 pre-absorbed mouse α-V5 primary antibody (R960-25, Thermo Fisher) was diluted to 1:800 in 1X PBS-BSA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Secondary antibody Alexa 488 donkey α-mouse (1:1000, Thermo Fisher Scientific #A21202) was diluted in blocking solution and incubated with samples for at least one hour ...
-
bioRxiv - Pathology 2020Quote: ... PPAR-α-specific mouse monoclonal antibody (1:1000 dilution, MA1-822, Thermo scientific), Hormone sensitive lipase (HSL)-specific rabbit monoclonal antibody (1:1000 dilution ...
-
bioRxiv - Physiology 2021Quote: ... followed by incubation with 1:250 secondary antibody (AlexaFluor594, mouse IgG2b; ThermoFisher, USA) for one hour at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and secondary antibody Horse Radish Peroxidase (HRP)-α-mouse (ThermoFisher Scientific, 1:10,000) in OneBlock buffer ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies were isotyped using the Rapid ELISA Mouse mAbs Isotyping Kit (ThermoFisher Pierce) with anti-mouse heavy chain capture antibody (anti-IgG1 ...
-
bioRxiv - Microbiology 2022Quote: ... and incubated with mouse α -V5 epitope tag monoclonal antibody (Invitrogen, 46-0705) for 1 hour at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibody: α-mouse Alexa Fluor®488 (1:200; Thermo Fisher Scientific). DNA was stained with 4,6-diamidino-2-phenylindole (DAPI) ...
-
bioRxiv - Microbiology 2022Quote: ... incubation with goat α-mouse Alexa Fluor 488 antibodies (2 µg/ml; Invitrogen) was performed for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... incubated with goat α-mouse Alexa Fluor 568 antibodies (2 µg/ml; Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... CRM1 and mouse monoclonal antibody for β-actin were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection was performed with a mouse Ub antibody (ThermoFisher, 14-6078-37, P4D1) followed by a Sulfo-tag labeled anti-mouse antibody (MSD ...
-
bioRxiv - Molecular Biology 2024Quote: ... Expression of the mouse CD8 α-chain was determined with fluoresceinated antibodies (Thermofisher). Secretion of the human coagulation factor VIII was determined by EliSpot assays ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse monoclonal antibodies to GAPDH (am4300) and GFP (ma5-15256) were from Invitrogen/Thermofisher Scientific and to Golg2a/GM130 (#66662 ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... Mouse monoclonal antibodies against GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (# 4300) were from Ambion. Secondary antibodies conjugated with horseradish peroxidase were from Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Pathology 2023Quote: ... an incubation with secondary antibodies against mouse-IgG (A647, Invitrogen A32728, 1:400) and rabbit-IgG (A555 ...
-
bioRxiv - Neuroscience 2023Quote: ... appropriate primary antibody receptor targeting1:2,000 mouse PSD-95 (cat # MA1-046,Thermofisher), 1:200 rabbit GluA1 (cat # AB1504 ...
-
bioRxiv - Microbiology 2023Quote: ... mouse monoclonal antibody against α-tubulin (GT114) (Invitrogen/Thermo Fisher Scientific, Ottawa, ON) was used at a dilution of 1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... mouse monoclonal antibody against α-tubulin (GT114) (Invitrogen/Thermo Fisher Scientific, Ottawa, ON) was used at a dilution of 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... or equal amounts of immunoglobulin G (IgG) isotype control mouse antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The following secondary antibodies were used: mouse-Alexa 488 (Invitrogen, cat. no. A21202); mouse-Cy3 (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies were visualized using Fluor 594 Goat-α-mouse (1:1000, Invitrogen, A11032 and Alexa Fluor 488 Goat-α-Guinea pig (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies used were: AF647 goat-a-mouse (1:1000; Life Technologies, A21236) and AF488 goat-a-rabbit (1:2000 ...
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Microbiology 2022Quote: ... eBioscience (minimal cross-reactivity to bovine/horse/mouse serum proteins)(Thermo Fisher Scientific 12-4998-82) diluted 1:200 in PBS/1% BSAfor 30 minutes.) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT) ...
-
bioRxiv - Neuroscience 2024Quote: ... endogenous proteins from the mouse cerebral cortex were dissected and lysed in RIPA buffer (Thermo Scientific) supplemented with 25 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-L5 (kindly provided by Woolford lab, 1:2000), mouse anti-L3 (kindly provided by the Warner lab, 1:5000) and mouse anti-Pgk1 (Invitrogen/Thermo Fisher, cat#459250, 1:10,000) diluted in blocking solution ...
-
bioRxiv - Immunology 2021Quote: ... at 4°C with 2µg anti-CD3 (mouse: eBioscience 14-0031-86; human: eBioscience 16-0037-85) and 1µg anti-CD28 (mouse: Invitrogen 14-0281-86; human: 16-0289-85) and either 7µg of Recombinant PD-L1/B7-H1 Fc Chimera Protein (mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed with PBS and incubated with secondary antibodies for 30 min at 37° C (1:1000 AF568 goat anti-mouse IgG1 Thermo Fisher Scientific, Cat. # A-21124; and 1:1000 AF647 goat anti-mouse IgG2a Thermo Fisher Scientific, Cat. # A-21241). Nuclei were stained with Hoechst (1 µM ...
-
bioRxiv - Developmental Biology 2019Quote: ... to remove RNA and DNA and then incubated overnight with the appropriate antibody and then incubated overnight with a 50:50 mixture of protein A and protein G Dynabeads (Thermo Fisher Scientific). Beads were washed three times with nondenaturing lysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2021Quote: ... Antibody-bound NLGNs were incubated for 1 hour with 20 µL of protein G beads (Dyna-beads Protein G, Thermo Fisher Scientific) precipitated and washed 4 times with lysis buffer ...