Labshake search
Citations for Thermo Fisher :
901 - 950 of 2043 citations for N Nitroso Di N Propylamine D14 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded in a 4-chamber glass bottom dish (D35C4-20-1-N, Invitrogen) for confocal imaging or in a 60 mm × 15 mm dish (705001 ...
-
bioRxiv - Biophysics 2023Quote: ... The slides were then incubated for 5 min in 0.1 N HCl (Fisher Scientific; S25354) and washed with 2xSSC (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... Pyrenyl-actin was made by labelling actin with N(1-pyrene)-iodoacetamide (Thermo Fisher Scientific) (Cooper et al ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 µg/mL fibronectin in DMEM F12 with 1 % N-2 supplement (Invitrogen #17502048), 1 % L-Glutamine (Biological Industries #03-020-1B) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transfection into cultured SK-N-AS cells was performed using Lipofectamine 2000 (Thermo Fisher Scientific) following standard protocols ...
-
bioRxiv - Microbiology 2024Quote: ... N sgRNA was detected using TaqMan™ Universal PCR Master Mix (Applied Biosystems – cat # 4304437) and each reaction contain ...
-
bioRxiv - Plant Biology 2024Quote: ... rafflesiana n = 3) were determined colorimetrically using the Bradford protein assay kit (Thermo Scientific, USA) with bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder, Applied Biosystems, in 10 μL of Hi-Di formamide, Applied Biosystems) and incubated at room temperature for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder [Applied Biosystems] in 10 μL of Hi-Di formamide [Applied Biosystems]) and incubated at room temperature for 20 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 98 U/mL or RNase1 (Thermo Scientific, EN0601) 0.06 U/mL when required ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Bioengineering 2023Quote: ... and ergosterol (98%; Acros Organics-Thermo Fisher Scientific) (420 g L-1 Tween and 10 g L-1 ergosterol ...
-
bioRxiv - Bioengineering 2023Quote: ... and ergosterol (98%; Acros Organics-Thermo Fisher Scientific) (420 g L-1 Tween and 10 g L-1 ergosterol ...
-
bioRxiv - Cell Biology 2020Quote: ... The following antibodies were used for immunoprecipitation and Western blotting: mouse N-cadherin (Thermo Fisher Scientific), HRP conjugated Strepavidin (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... with NuPAGE 3-(N-morpholino) propane sulfonic acid (MOPS) sodium dodecyl sulfate (SDS) running buffer (Invitrogen). Proteins were then transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 4 mice pooled per n) were deeply anesthetized and perfused intracardially with ice-cold dPBS (Gibco). Forebrain tissue were aseptically dissected ...
-
bioRxiv - Developmental Biology 2021Quote: ... Flag-Tdrd3-N and Flag-Tdrd3-C were synthesized with an mMESSAGE mMACHINE SP6 kit (Ambion), and the resulting mRNAs (2 μg ...
-
bioRxiv - Developmental Biology 2021Quote: ... or 1 µl (1.1 µg/µl) anti-V5 antibody (Cat. No. P/N 46-0705, Invitrogen), or 20 µl anti-C2CD6 (UP2429 ...
-
bioRxiv - Genomics 2020Quote: ... and total RNA was extracted from five (n=5) COVID-19 positive patients using TRIzol (Invitrogen) reagent following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... n=3 pellets/condition/cell-type) and cultured in differentiation media (StemPro Chondrogenic Media; ThermoFisher Scientific) for 28 days ...
-
bioRxiv - Neuroscience 2020Quote: ... and Kcns3neo/neo mice (n=5 per genotype) and homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA). Total RNA samples were prepared from the homogenates using RNeasy lipid tissue mini kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Neuroscience 2020Quote: ... N-terminally HA-tagged AMPAR constructs were expressed from the doxycycline inducible pcDNA4/TO vector (Invitrogen Cat ...
-
bioRxiv - Biophysics 2022Quote: DDM-solubilized claudin-4 was biotinylated using N-hydroxysuccinimide polyethylene glycol biotin (NHS-PEG4-biotin, ThermoFisher) by mixing 5.6 μM claudin-4 with 16.8 μM NHS-PEG4-biotin ...
-
bioRxiv - Biochemistry 2020Quote: F-actin was labeled with N-(1-pyrene) iodoacetamide (PIA) (Invitrogen, Thermo Fisher Scientific, Waltham, MA) essentially as described previously (17,20) ...
-
bioRxiv - Biochemistry 2020Quote: F-actin was labeled with N-(1-pyrene) iodoacetamide (PIA) (Invitrogen, Thermo Fisher Scientific, Waltham, MA) essentially as described previously (17,20) ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissue or cells were lysed in N-PER™ Neuronal Protein Extraction Reagent (#87792, Thermo Fisher) supplemented with protease and phosphatase inhibitor cocktail (#78440 ...
-
bioRxiv - Microbiology 2021Quote: ... All toxins and chimeras were expressed and purified with cleavable N-terminal 6His-SUMO fusions (ThermoFisher), grown to an OD600 of 0.8 in LB media ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissue or cells were lysed using N-PER™ Neuronal Protein Extraction Reagent (#87792, Thermo Fisher) supplemented with protease inhibitor cocktail (#5871S ...
-
bioRxiv - Microbiology 2021Quote: ... and 25 ng linear pPolI-SARS-CoV2-NLuc-N plasmid using 2μl of Lipofectamine 2000 (Invitrogen) to a DNA:lipofectamine ratio of 1:3 and 100μl Opti-MEM (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell viability (n =3) was assayed at different times using the PrestoBlue cytotoxicity assay (Thermo Fisher), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The N-based assay used a standard curve synthesized as follows: T7 in vitro transcription (ThermoFisher) of a synthetically produced N sequence (IDT ...
-
bioRxiv - Physiology 2021Quote: ... homogenized individually (N = 30 per condition and per independent experiment) in 500 μl of TRIzol (Invitrogen) and stored at −80°C until RNA extraction.
-
bioRxiv - Cell Biology 2020Quote: ... the N-terminal His6-tag was removed by the addition of His6-rTEV protease (Life Technologies) and dialyzed in H Buffer for 36 h at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Neuroscience 2022Quote: ... compound and sectioned into six series of 40μm coronal sections (Microm HM N°560, Thermo Scientific) into 1xPBS containing 0.1% sodium azide ...
-
bioRxiv - Microbiology 2020Quote: ... Amersham Hybond-N+ nylon and Amercham Hybon-XL nitrocellulose membaranes were purchased from ThermoFisher (Illkirch, France).
-
bioRxiv - Microbiology 2020Quote: ... the sequence of the plasmid EGFP-N was confirmed by sequencing (Gene Art–Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The hiPSCs were maintained on vitronectin (VTN-N; cat. num. A14700; Thermo Fisher Scientific, Waltham, MA)-coated plates in Essential 8 Flex medium (E8 ...
-
bioRxiv - Microbiology 2022Quote: ... The online desalting column (trap column) used was a C18 column (Thermo Scientific P/N 160454). At 4.6 min the flow from the nano pump was diverted to the trap column in a backward flush direction ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Total RNA was isolated from liver tissues (n=4-5 mice/group) using Trizol (ThermoFisher Scientific). Concentration was measured by nanodrop (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: Proteins were extracted from iPSC using N-PER™ Neuronal Protein Extraction Reagent (Thermo Fisher Scientific) supplemented with protease (cOmplete™ Mini Protease Inhibitor Cocktail ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase I digestion was stopped by adding 10U of Superase Inhibitor (Thermo Scientific, cat. n° AM2696) for 10 min on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Validation of second strand synthesis was performed by Nuclease S1 digestion (Thermo Fisher, cat n°EN0321) according to manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... After the final wash cells were resuspended in PBS with 1% BSA (ThermoFisher, Cat. N: AM2618) and the cell number as well as viability were assessed using Countess™ II Automated Cell Counter (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... the N and ORF1ab were detected using FAM and VIC labelled Taqman probe by Applied Biosystems™ 7500 (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... Laser Capture Microdissection (LCM; N=3; 7 µM glass slide coated with polyethylene naphthalate – ThermoFisher #LCM0522), multiplex or regular immunohistochemistry (N≥3 4 µM glass slide ...
-
bioRxiv - Microbiology 2021Quote: ... antibodies were raised against a peptide containing an N-terminally derived sequence (ERQTQSSLEDSDDQFGDPR, Thermo Fisher, USA) (1:500 dilution of serum) ...