Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for Killer Cell Immunoglobulin Like Receptor 2DL3 KIR2DL3 Antibody PE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... and were incubated in secondary antibodies (1:1000, v/v, goat anti-mouse or goat-anti rabbit immunoglobulin G conjugated to Cy3 or Alexa Fluor 647, Thermo Fisher Scientific), Alexa Fluor 488 or rhodamine phalloidin (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were washed with PBS and then stained for 15min at 4 °C in Flow buffer (PBS with 5% cosmic calf serum) containing the following antibodies: CD11b-PE (Invitrogen, 12-0112-82), CD45-APC (Biolegend ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were stained with antibodies of cytokines (anti-IFN-gamma [Biolegend, 505808], anti-IL-2 [Biolegend, 503822], anti-IL-13 PE/Cy7 [Invitrogen, 25-7133-82]) at 4°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... washed with D-PBS and further incubated with a monoclonal antibody against CD11c conjugated with PE-Cyanine7 (1:200; Thermofisher 25-0114-82) for 30 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... were used at a concentration of 1:100 then stained with anti-rabbit-PE or anti-mouse Pacific Blue secondary antibody (BioLegend® #406421, Life Technologies #P10993) for flow cytometry.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then resuspended in a 100 μL solution of PBS containing an antibody targeting human CD45 conjugated to PE-Cy7 (Invitrogen, 25-9459-42) and incubated for 30 minutes in the dark at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... antibodies after staining the cells with cKit-APC antibody (Thermo Fisher Scientific) for 30 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... surface receptors were labeled with Pierce™ Premium Grade Sulfo NHS-SS-Biotin (Thermofisher, Waltham, USA) and purified using Streptavidin High Performance Spintrap™ (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Receptor and chemokine baculovirus stocks were produced using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... and IGF-1 receptor (Catalog number: AM51331, siRNA ID:110754) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen), according to manufacturer’s established protocol ...
-
bioRxiv - Neuroscience 2023Quote: Stably expressing 5-HT receptor Flp-In 293 T-Rex Tetracycline inducible system (Invitrogen, mycoplasma-free) were used for calcium flux assays ...
-
bioRxiv - Evolutionary Biology 2024Quote: The chemicals used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were stained with secondary antibodies (ThermoFisher) for 1h at room temperature followed by phalloidin Alexa546 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cut yolk sac-like regions are transferred into a tissue culture-treated dish containing Essential 6™ Medium (E6, Gibco, cat #A1516401) with 1% Geltrex ...
-
bioRxiv - Developmental Biology 2020Quote: ... Strep-PE-Cy7 (Invitrogen, 25-4317-82, 1:250), CD24-PE (Biolegend ...
-
bioRxiv - Molecular Biology 2020Quote: ... CD71 PE-Cy7 (OKT9; Affymetrix, Santa Clara, CA, USA), and CD235a PE (GPA)(GA-R2 ...
-
bioRxiv - Bioengineering 2020Quote: ... or PE-conjugated anti-Fab (Thermo Scientific, #MA1-10377) for an additional 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... PE rat anti-mouse TER-119 (1:200; Invitrogen), PE rat anti-mouse CD45 (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: CD11b-PE-Cy7 (Thermo Fisher Scientific, 25-0112-82), Rat IgGk Isotype Control-PE-Cy7 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Alexa546 or phycoerythrin (PE) were purchased from Thermo Scientific, USA ...
-
bioRxiv - Cancer Biology 2020Quote: ... PE/Cy5 anti-mouse IA/IE (M5/114.15.2, Invitrogen), PE/CF594 anti-mouse NK1.1 (PK136 ...
-
bioRxiv - Microbiology 2022Quote: ... PE-conjugated anti-IL-2 (Invitrogen/eBioscience Thermo Fisher), and BV421 rat anti-TNF-α (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... and CXCR5 PE-Cy7 (clone MU5UBEE, Thermo Fisher Scientific). Stained cells were then incubated with streptavidin-BV605 (BD Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... PE-conjugated anti-IL-2 (Invitrogen/eBioscience Thermo Fisher), and BV421 rat anti-TNF-α (BD Biosciences ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-CD4 (Invitrogen 25-0041-82, PE-Cy7 conjugated), anti-CD8a (Invitrogen 47-0081-80 ...
-
bioRxiv - Microbiology 2021Quote: ... PE-conjugated mouse anti-HLA-DR (clone LN3, Invitrogen); PE-Cy7-conjugated mouse anti-CD11b (clone ICRF44 ...
-
bioRxiv - Microbiology 2021Quote: ... Pierce™ Protein Concentrator PES (Thermo Fisher Scientific, 88517) and Zeba™ Spin Desalting Columns ...
-
bioRxiv - Immunology 2020Quote: ... anti-B220 (PE-Cy7; clone RA3-6B2; Thermo Fisher), anti-Fas (APC ...
-
bioRxiv - Immunology 2021Quote: ... and CXCR5 PE-Cy7 (clone MU5UBEE, Thermo Fisher Scientific). Cells were washed twice in wash buffer and residual red blood cells were lysed using BD FACS Lysing Solution (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... streptavidin-eFluor450 and streptavidin-PE-Cy7 from Thermo Fisher. α-CCR5-PE (clone 2D7) ...
-
bioRxiv - Immunology 2022Quote: ... and streptavidin R-PE conjugate (Invitrogen, Thermo Fisher Scientific). Cells were then washed and resuspended in FACS buffer ...
-
bioRxiv - Immunology 2022Quote: ... and streptavidin R-PE conjugate (Invitrogen, Thermo Fisher Scientific). Cells were then washed and resuspended in FACS buffer ...
-
bioRxiv - Immunology 2022Quote: ... and CD278/ICOS PE (ISA-3, Thermo Fisher Scientific). Cells were stained as described above ...
-
bioRxiv - Cancer Biology 2022Quote: ... PE-Texas Red_CD45 (1:200, Thermo Fisher Scientific, #MCD4517), APC/Cy7_TCR β (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... or PE-conjugated for Ac2GSL (Life Technologies, Carlsbad, CA)) ...
-
bioRxiv - Genetics 2020Quote: ... VIC fluorophore-labeled primers (PE Applied Biosystems, Warrington, UK) modified following (Pereira-Lorenzo et al ...
-
bioRxiv - Microbiology 2020Quote: ... Pierce™ Protein Concentrator PES (Thermo Fisher Scientific, 88517) and Zeba™ Spin Desalting Columns ...
-
bioRxiv - Microbiology 2021Quote: ... Foxp3-PE (Thermo Fisher Scientific, Cat# 12-5773-82), T-bet-APC (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... anti-KLRG1-PE-Cy7 (1:300, clone 2F1, Invitrogen), anti-CD44-APC (1:5000 ...
-
bioRxiv - Genomics 2021Quote: ... added PE Annexin (1:200; ThermoFisher, cat. no. L34960) and incubated 30 minutes at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and CXCR5 PE-Cy7 (clone MU5UBEE, Thermo Fisher Scientific). Cells were washed twice in wash buffer and then incubated with streptavidin-BV605 (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... anti-TNFα-PE (Clone Mab11, Invitrogen 12-7349-82) and anti-IFN-γ-FITC (BD 554551 ...
-
bioRxiv - Immunology 2021Quote: ... and FoxP3 (PE, Invitrogen, 1:100, clone FJK-16s). Cells were stained in HBSS ...
-
bioRxiv - Immunology 2021Quote: ... CD11c (PE-Cy5.5, Thermo Fisher, 1:100, clone N418), CD11b (PerCP-Cy5.5 ...
-
bioRxiv - Immunology 2020Quote: ... anti-F4/80 PE-Cy5 (1:200, BM8, Invitrogen), anti-CD88 anti-APC (1:800 ...
-
bioRxiv - Cell Biology 2020Quote: ... CD49f-PE-Cy7 (1:100; Invitrogen 25-0495-82); EpCAM-APC (1:63 ...
-
bioRxiv - Bioengineering 2020Quote: ... or PE-conjugated anti-Fab (Thermo Scientific, #MA1-10377) for additional 30 min ...
-
bioRxiv - Immunology 2022Quote: ... FOXP3 PE (clone PCH101, Invitrogen, cat# 12-4776-41), PD-1 BV605 (clone EH12.2H7 ...