Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for Killer Cell Immunoglobulin Like Receptor 2DL3 KIR2DL3 Antibody PE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Development of follicular dendritic cells in lymph nodes depends on retinoic acid mediated signalingbioRxiv - Immunology 2020Quote: ... 300nM of each primer and SYBR Green Mastermix (PE Applied Biosystems). From a set of 8 housekeeping genes ...
-
bioRxiv - Immunology 2021Quote: ... CD86-PE (clone GL1, Thermo Fisher 12-0862-85, 1:400) and PE-conjugated tetramers (control ...
-
bioRxiv - Cell Biology 2021Quote: ... CD45-PeCy7 and CD31-Pe (eBioscience) in 2%FBS/HBSS (ThermoFisher) and sorted using Influx or Aria II Sorter (BD) ...
-
bioRxiv - Immunology 2022Quote: ... and anti-Tbet-PE (Invitrogen 12-5825-82: Clone: 4B10, eBioscience) (1:25 ...
-
Simultaneous adjunctive treatment of malaria and its co-evolved genetic disorder sickle cell anaemiabioRxiv - Microbiology 2022Quote: ... PE-Cy7 (clone 30-F11, 25-0451-82, Thermo Fisher Scientific). After incubation ...
-
bioRxiv - Immunology 2024Quote: ... and biotinylated human BCMA (Bio-connect) with streptavidin-PE (Thermo Fisher). For intracellular staining ...
-
bioRxiv - Cancer Biology 2024Quote: ... PE/Cy7-anti-CD33 (1:100; Thermo fisher 25-0338-42), PE/Cy7-anti-CD15 (1:100 ...
-
bioRxiv - Biochemistry 2024Quote: ... hamster anti-mouse CD95 clone JO2 PE conjugate (Fisher Scientific, BDB554258), rat anti-mouse GL-7 Pacific Blue conjugate (BioLegend ...
-
bioRxiv - Biochemistry 2024Quote: ... All media was filtered by 0.2 µM PES filter (Fisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... and concentrated with PierceTM Protein Concentrator PES 50K MWC0 (ThermoFisher Scientific) at 14,000 g at room temperature up to 2 ml per plate ...
-
bioRxiv - Immunology 2023Quote: ... or 1:100 (anti-CD127/IL7Rɑ: PE, Invitrogen, #12-1271-83) antibody to cell suspension volume ratio for an additional 15-30 min on ice ...
-
bioRxiv - Microbiology 2023Quote: ... and PE-anti-MCHII (14-4-4S; 12-5980-82 Invitrogen). Samples were then washed in 2% FBS-PBS wash buffer and fixed overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... sterile filtered using 0.22 µm PES filters (Fisher Scientific, NY, USA)) and 300 mM sucrose was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD31-PE-Cy7 (Invitrogen, clone 390, 25-0311-81, 1:200), TCRgd-APC (BioLegend ...
-
bioRxiv - Cell Biology 2023Quote: ... or 0.45 μm PES filters (Thermo Fisher Scientific, 50-607-518), and frozen at -80°C.
-
bioRxiv - Immunology 2023Quote: ... and phycoerythrin (PE)-conjugated anti-mouse IgG was added (ThermoFisher, 31861) at a concentration of 0.5μg/mL and incubated shaking at RT for 1 hour ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-CD144 PE (2:100, Thermo Fisher Scientific, Ghent, Belgium), and the following two antibodies in the second cocktail ...
-
bioRxiv - Immunology 2023Quote: ... PE-Cyanine7 Rat Anti-Mouse IgM (Clone II/41; ThermoFisher(Ebioscience); Cat#25-5790 ...
-
bioRxiv - Bioengineering 2023Quote: ... at 1:1000 dilution for OX40 or neutravidin-PE (Invitrogen, A2660) at 1:300 for CD137 for antigen binding ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.2 µm PES membrane filter (Thermo Scientific, cat# 09-741-07), HPLC-grade methanol and acetonitrile were purchased from Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... PE-conjugated rat anti-mouse GATA3 (clone TWAJ; Thermo Fisher Scientific), or FITC-conjugated rat anti-mouse Foxp3 (FJK-16s ...
-
bioRxiv - Cell Biology 2023Quote: ... or 0.45 μm PES filters (Thermo Fisher Scientific, 50-607-518), and frozen at -80°C.
-
bioRxiv - Cancer Biology 2024Quote: ... CD69-FITC/APC/PE-Alexa Flour 610 (clone FN50; Thermo fisher), HLA-DR-PerCp/cy5.5 (clone LN3) ...
-
bioRxiv - Immunology 2024Quote: ... and mouse IgG1-PE-Cy7 isotype control (clone P3.6.2.8.1, eBioscience/Invitrogen). The cells were stained for 1hr at RT and washed 3 times prior to analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Anti PCNA-PE conjugate (1:200) (Invitrogen, 12-910-42). Cells were then washed and resuspended in DAPI staining solution (0.1% (v/v ...
-
bioRxiv - Immunology 2024Quote: ... SiglecF PE (Invitrogen, CAT# 12-1702-82, clone 1RNM44N, 1:500), CD11b BV 510 (Biolegend ...
-
bioRxiv - Immunology 2024Quote: ... and PE-Cy7 mouse IgG1 κ isotype (clone P3.6.2.8.1, ThermoFisher Scientific). The flow cytometer was FACS Verse system (BD Biosciences) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... anti-CD170 (SiglecF)-PE-Cy7 (25-1702-82, Invitrogen, 1:100), and APC streptavidin (405307 ...
-
bioRxiv - Bioengineering 2024Quote: ... and anti-EOMES (PE-Cy5, Thermo Fisher Scientific, 15-4875-82) antibodies to stain at room temperature for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... IL-4 (Th2) (APC) or IL17a (Th17) (PE-Cy7) (Life Technologies, Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... CD45.1-PE/Cy7 (Tombo Biosciences) and CD45.2-BV421 (Thermo Fisher Scientific) for C57BL/6 mice samples ...
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the short transcriptional variant of human DA D2 receptor with an N-terminal FLAG tag (SF-D2R-S) was inserted into mammalian expression vector pcDNA 3.1(+) (Invitrogen)62 ...
-
bioRxiv - Cell Biology 2020Quote: ... the surface receptors were labeled with 0.133 mg/ml of EZ-Link Sulfo-NHS-SS-Biotin (Thermo scientific, 21331) in PBS at 4 °C for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... This master mix was added to premade 96 well TaqMan Array plates with chemokine/chemokine receptor primers (Thermo Fisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Microbiology 2021Quote: Vero cells that stably express the canine receptor CD150 (Vero-cCD150) were grown in advanced Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% (V/V ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVEC samples were treated with an Fc receptor blocking reagent (1 test) (Thermo Fisher Scientific, Cat. # 14-9161-73) and incubated at 4°C for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... cells and baby hamster kidney cells stably expressing the MHV receptor (BHK-R) were maintained at 37°C in Dulbecco’s modified Eagle medium (DMEM; Gibco), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... in which cells were stained with anti-IgG PE (Miltenyi #130-093-193, 1:50 dilution) and SYTO-62 (Invitrogen, 1:500 dilution) for 20 minutes at 4C ...
-
bioRxiv - Cell Biology 2023Quote: ... ∼800K live epithelial cells per mouse were then isolated by flow cytometry by sorting for DRAQ7- CD45- PE+ cells directly into Trizol LS (Ambion 10-296-010) on a FACSJazz Sorter ...
-
bioRxiv - Cell Biology 2021Quote: ... For knockdown experiments MIN6 cells were resuspended with 25 nM antiGABA-B1 receptor or control siRNA (Dharmacon, siGENOME) pre-mixed with 1.6 μl/ml Lipofectamine RNAiMAX (Life technologies) in Opti-MEM I medium ...
-
bioRxiv - Cell Biology 2020Quote: Parent CHO-K1 and CHO-K1 cells stably expressing extracellular ACP-tagged human insulin receptors were maintained at 37°C with 5% CO2 in HAM’s F-12 medium (Thermo Fisher) supplemented 10% fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the receptor Fc-tagged ectodomains present in the conditioned media were captured on protein A-coated 384-plates (Thermo Scientific), and stored at 4 °C until use ...
-
bioRxiv - Immunology 2020Quote: ... For neutralization assays HEK 293T expressing the SARS-CoV-2 receptor ACE2 (HEK 293T/ACE2) were cultured in DMEM (Gibco), supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Physiology 2020Quote: ... βTC3 cells were transfected with plasmids encoding mouse furin and/or mouse insulin receptor (pcDNA3.1 backbone) and/or mouse Atp6ap1/Ac45-Flag using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and 20uL was added to each well of a 96 well TaqMan Array plate with chemokine/chemokine receptor primers (ThermoFisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293A cells expressing dopamine receptor sensors or other constructs were prepared on cover-glass-bottom dishes coated with 10 μg/ml of fibronectin (Gibco). Various concentration of dopamine or other ligands were added to the cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells expressing either the paternal or maternal allele (or both) of the receptor studied were sorted and expanded for 1 week in RPMI 1640 (ThermoFisher) containing 200 U/mL recombinant IL-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were then processed for real-time polymerase chain reaction (RT-PCR) to assess the expression of the oxytocin receptor (primers and probe assay ID: Rn00564446_g1, purchased from Life Technologies). In particular ...
-
bioRxiv - Biophysics 2024Quote: mRNA encoding the ρ1-EM GABAA receptor was produced by in-vitro transcription using the mMessage mMachine T7 Ultra transcription kit (Ambion) according to the manufacturer protocol ...