Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for 6 TRIFLUOROMETHYL 1 2 3 4 TETRAHYDRO ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Molecular Biology 2023Quote: ... cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI) (HiMedia) and then observed under the EVOS FL imaging system (Thermo Fisher Scientific) using both DAPI and GFP channels ...
-
bioRxiv - Neuroscience 2024Quote: ... Sciatic nerves of 6 mouse pups between postnatal days 2 and 4 (P2 and P4) were collected in L15 medium (Thermofisher, Massachusetts, USA) and incubated for 30 min in 2 mg/mL collagenase II and then 10 min in 0.25 % trypsin containing EDTA at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM Mg(OAc)2 (Invitrogen), 0.55 mM spermidine (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... third instar larvae were dissected in zero Ca2+ HL-3 solution at room temperature and stimulated with a HL-3 solution of 90 mM K+/2 mM Ca2+/4 μM FM4-64 (Invitrogen) for 5 min to load FM4-64 dye into the boutons ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were treated with RNAScope H2O2 for 4 min at RT and subsequently washed 2 x 3 min with UltraPure Distilled Water (Invitrogen) at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... were crossed for 2-3 days and then transferred to fly food made from 0.6 g of Carolina Formula 4-24 (Fisher Scientific) and 2 mL of ddH2O ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 0.5:1:0.1 (4 μg/6-well dishes) using Lipofectamine LTX PLUS (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Neuroscience 2019Quote: ... harbouring the full-length cDNA coding for the human muscle 6-phosphofructo-1-kinase muscle isoform (PFK1-M)3 (accession number, NM_000289.1) using Lipofectamine LTX-PLUS Reagent (Life Technologies) according with manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... metaphase II-arrested eggs were microinjected with 2-3 picolitres of Rec8 antiserum (13) (1:2 dilution) and Alexa Fluor 488 Dextran 10,000 MW (Molecular Probes, D22910; 1:40 dilution) in 0.05% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotech ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 4-6 days with Versene solution (Gibco). A control iPS cell line (MIN09i-33114.C ...
-
bioRxiv - Physiology 2020Quote: ... and sectioned (4-6 micron) using a Microm HM 325 (ThermoFisher). Tissue sections were then stained with Weigert’s iron hematoxylin and Masson Trichrome (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg plasmid and 6 µl Turbofect (Thermo Fisher Scientific, USA) were combined ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were labeled with DAPI (4’,6-diamidino-phenylindole, Invitrogen) and subsequently mounted onto a glass slide and cover-slipped using an antifade mounting medium.
-
bioRxiv - Cell Biology 2024Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotec ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Bioengineering 2021Quote: FBS free culture media with 15mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Gibco) in DMEM/F12 supplemented with 1% P/S was used for all experiments performed in the lung on a chip devices ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 1M (ThermoFisher, ref. 15630106) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 1-2 x 107 cells were incubated in 4 µM PBS-diluted CFSE (Invitrogen) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Neuroscience 2021Quote: ... The nuclei of astrocytes and autaptic neurons were visualized by counterstaining with 4’,6-diamidino-2-phenylindole (DAPI)-containing mounting medium (ProLong® Gold Antifade Reagent with DAPI, Thermo Fisher Scientific). Only neurons with one nucleus were analyzed when counting synapse numbers.
-
bioRxiv - Microbiology 2022Quote: ... 0.1% Triton X-100 in PBS for 20 minutes, then were actin stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) nucleic acid stain (Thermo Fisher Scientific, USA) in PBS for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were again washed and incubated for 10 min in a solution of 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific). Cells were imaged using a Leica DM IRB epifluorescence microscope ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).