Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 6 TRIFLUOROMETHYL 1 2 3 4 TETRAHYDRO ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... then incubated for 2h at room temperature with Alexa Fluor secondary antibodies (S2 Table) and nuclear staining with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Images were captured on a BX51 fluorescence microscope (Olympus ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we stained the formaldehyde preserves with DAPI (4’,6-diamidino-2-phenylindole, final concentration 5 ug/mL, Thermo Scientific, USA), and counted the microbial cells using hemocytometers (DHC-N01 ...
-
bioRxiv - Microbiology 2022Quote: ... for 30 minutes at RT followed by a 5-minute incubation with 300 nM 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) diluted in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein lysates were combined with 6× loading buffer containing 2-mercaptoethanol and loaded on NuPAGE 4%-12% Bis-Tris Midi gels (Invitrogen). After separation of protein by SDS-PAGE ...
-
bioRxiv - Cell Biology 2022Quote: ... Hoechst 43222 (H1399) and ProLong Gold Antifade Mountant with 4′,6- diamidino-2-phenylindole (DAPI; P36931) were purchased from Invitrogen.
-
bioRxiv - Cell Biology 2022Quote: ... The plates were then washed with PBS 3×10min at RT on a shaking plate and cell nuclei were stained with 20 μg/ml DAPI (4’,6-Diamidino-2-Phenylindole, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were then washed with 1xPBS and incubated with μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies, #D1306). Coverslips were then mounted in Vectashield (LSBio ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then fixed in 4% formaldehyde at room temperature for 10 minutes and mounted onto slides using ProLong Gold or Diamond Antifade Mountant with 4′,6-diamidino-2- phenylindole (DAPI) (ThermoFisher). Images were obtained using a Leica SP8 confocal microscope using excitation/emission spectra ...
-
bioRxiv - Molecular Biology 2022Quote: ... the sections were mounted with ProLong Gold with 4′,6-diamidino-2-phenylindole (DAPI) (catalog no. P36935, Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: The membrane probes Di-4-ANEPPDHQ and Laurdan (6-dodecanyl-2-dimethylaminonaphtalene) were obtained from Molecular Probes (Eugene, OR, USA) and dissolved in ethanol and dimethyl sulfoxide (DMSO ...
-
bioRxiv - Biochemistry 2023Quote: The cells were seeded in 6 well plate and treated the next day using 2 µg of plasmid and 4 µL of lipofectamine 3000 (Invitrogen) for 24 h or 10 nM of siRNA and 5 µL of RNAiMAX (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3×106 MART-1-transduced T cells were added and incubated for the indicated hours (2, 4 or 6) in “Intermediate” 4K6R medium consisting of RPMI 1640 Medium for SILAC (88365, Thermofisher) with 10% dialyzed fetal bovine serum (15605639 ...
-
bioRxiv - Cell Biology 2023Quote: Binucleation analyses and detection of aberrant divisions were performed by heat-fixing cells on a microscope slide at 70 °C before staining with 4’,6-diamidino-2-phenylindole (DAPI) (SlowFade Diamond Antifade Mountant with DAPI, Invitrogen) and Calcofluor (Sigma) ...
-
bioRxiv - Bioengineering 2023Quote: PAAm gels prepared on coverslips were transferred to multiwell plates before covering with 0.2 mg/mL sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH) (Thermo Fisher) solution ...
-
bioRxiv - Cell Biology 2024Quote: ... a working solution of 0.83 mg/mL solution of sulfosuccinimidyl 6-(4′-azido-2′-nitrophenylamino)hexanoate (sulfo-SANPAH, 22589; Thermo Fisher) in PBS was prepared from a stock solution of 83 mg/mL sulfo-SANPAH in DMSO (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... in blocking buffer prior to a final incubation with 4′,6-diamidino-2-phenylindole (DAPI) or anti-phalloidin for F-actin (Invitrogen) at 25 °C ...
-
bioRxiv - Genetics 2023Quote: ... ISE6 cells were fixed with 4% paraformaldehyde followed by 1 x PBS washes and the coverslip was mounted on a slide using Antifade gold mounting reagent with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen) and observed under the Nikon W-1 Spinning Disk confocal microscope ...
-
bioRxiv - Neuroscience 2024Quote: ... Hippocampal sections were stained with 4’,6-diamidino-2-phenylindole (DAPI) and cresyl violet or fluorescent Nissl (NeuroTrace 435/455 Blue, ThermoFisher). OFC and mPFC sections were stained to visualize glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were resuspended in a flow-cytometry buffer and DAPI (4′,6-diamidino-2-phenylindole, 0.5 μg/ml; ThermoFisher #D1306) solution to exclude dead cells ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 1:1:0.1 (4 μg/6-well dishes) by using Lipofectamine LTX PLUSTM (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then dipped in the secondary antibody-containing buffer with the nuclear dye 4′,6-diamidino-2-phenylindole (DAPI, Cat# D1306, Life Technologies-Invitrogen, Carlsbad, CA, USA, dilution 1:400), for 2 hours at RT ...
-
bioRxiv - Genomics 2021Quote: ... enzymatic dissociation was performed for 4–6 minutes at 37°C in 1 mL TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 mL of TRIzol (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... enzymatic dissociation was performed for 4–6 min at 37 °C in 1 ml TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 ml of TRIzol (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained with 4’,6diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) at 37 °C for 5 min in PBTX solution ...
-
bioRxiv - Microbiology 2019Quote: ... and 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher), referred to as complete DMEM (cDMEM) ...
-
bioRxiv - Neuroscience 2022Quote: ... On day 4 cells were passaged 1:2 with Stempro Accutase (Invitrogen) for 5 minutes at 37C and replated on hESC qualified Matrigel® ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 24 mL 5% NaHCO3 (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) were purchased from Gibco/Thermo Fisher Scientific (Grand Island ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene, Invitrogen) stock solution was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (Thermo Fisher Scientific, D1306) for 45 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Molecular Probes).
-
bioRxiv - Microbiology 2020Quote: ... 6 diamidino-2-phenylindole (DAPI) (ThermoFisher scientific, 10116287) and mounted with Fluoromount-G (Cambridge Bioscience) ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidine-2′-phenylindole dihydrochloride (Thermo Fisher Scientific) was added for nuclear counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... 2-6 mL (Thermo Scientific, catalog no. 88516), and the final protein concentration was measured via A280 absorbance.
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Thermofisher Scientific). The mountant was allowed to cure overnight and coverslips were analysed on an Olympus FV3000 confocal microscope.
-
bioRxiv - Pathology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, USA). Samples were visualized with a fluorescence microscope (Olympus ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Microbiology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) at 37 °C for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, 62248) was used to eliminate dead cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific). IHC and IF stained slides were imaged using the Olympus BX53F epifluorescence microscope (Center Valley ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 diamidino-2-phenylindole (DAPI; ThermoFisher Scientific, 10,116,287) and mounted on slides with Fluoromount-G from Southern biotech (ThermoFisher Scientific ...
-
Polarized Mechanosensitive Signaling Domains Protect Arterial Endothelial Cells Against InflammationbioRxiv - Cell Biology 2023Quote: ... Laurdan dye (6- Dodecanoyl-2-Dimethylaminonaphthalene) (Invitrogen #D250) was applied at 10 μM to cell monolayers and incubated 30 min at 37°C then washed and imaged in 1X HBSS ...
-
bioRxiv - Biophysics 2023Quote: ... and 6-dodecanoyl-2-dimethylaminonaphthalene (LAURDAN) from Thermofisher Scientific (USA) ...
-
bioRxiv - Immunology 2023Quote: ... 2-6 mL (Thermo Fisher Scientific/ Pierce, 88521) Pierce™ Protein Concentrators PES ...