Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... we stained the formaldehyde preserves with DAPI (4’,6-diamidino-2-phenylindole, final concentration 5 ug/mL, Thermo Scientific, USA), and counted the microbial cells using hemocytometers (DHC-N01 ...
-
bioRxiv - Microbiology 2022Quote: ... for 30 minutes at RT followed by a 5-minute incubation with 300 nM 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) diluted in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Ss06901209_m1), fibulin-5 (FBLN5, Ss04805024_m11) and samples were run on a QuantStudio 6 Real-Time PCR system (Applied Biosystems #4485694) in technical and biological replicates (n = 3-5) ...
-
bioRxiv - Biophysics 2022Quote: Fibroblasts grown in vitro to the third passage were plated in 6-well tissue culture plates (5 × 105 cells per well) in DMEM (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... or 5’-TCAAGGTCCCTGATAATTATGGCGA-3’) or scrambled siRNA (non-targeting control) using 6 μL Lipofectamine™ RNAiMAX (Invitrogen™ - Cat.# 13778075). After 24 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cancer Biology 2023Quote: Rhodamine tubulin was generated by labeling tubulin with X-rhodamine SE (5(and-6) carboxy-X-rhodamine succinimidyl ester) dye (ThermoFisher). Labeling stoichiometry was determined using a molar extinction coefficient of 115,000 M-1 cm-1 for tubulin and 78,000 M-1 cm-1 for X-rhodamine [58] ...
-
bioRxiv - Cell Biology 2023Quote: ... which were blotted with a force of 6 for 5 seconds and immediately vitrified by plunge-freezing in liquid ethane using a Vitrobot Mark IV (ThermoFisher) operating at 4 °C and 100% humidity ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 µg of plasmid was used to transfect 750,000 cells in each well of a 6-well plate using Lipofectamine 2000 (5 µL; Thermo Fisher) in OptiMEM (400 µL ...
-
bioRxiv - Plant Biology 2021Quote: ... two SlP4H3 OEX lines (#1, #2) and three SlP4H3 RNAi lines (#1, #6 and #7) by using the TRI reagent (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription of approximately 1 μg of total RNA was performed with Superscript II® Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2019Quote: ... 5 μL of 5 mg/mL streptavidin-labeled with Alexa Fluor 488 (ThermoFisher Sci.) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL IL-1β and 5 ng/mL IL-23 from Invitrogen (14823163) (Th17.1s ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 × 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI with 5% fetal bovine serum and 5 μM Lysotracker deep red (ThermoFisher Scientific) was used following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 µL of each SF was diluted 7-fold in water and used for a Bradford protein assay (Thermo Fisher Scientific, Rockford, IL).
-
bioRxiv - Molecular Biology 2022Quote: ... 4ºC) and incubated with 50 μL of 5 μM DAF-FM (4-amino-5methylamino-2’,7’-dichlorofluorescein diacetate, Life Technologies, Eugene, OR, USA) diluted in 1X PBS for 30 min at 34 °C ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Biophysics 2022Quote: African green monkey kidney cells (COS-7) were cultured at 37°C and 5 % CO2 in DMEM medium containing glutamax (Gibco No. 31966-047), 10 % fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: Fast-growing human embryonic kidney 293T cells (HEK293FT) were maintained in DMEM 10% FBS (v/v) and passaged at 5-7 day intervals with TrypleExpress (Invitrogen GIBCO, Paisley, UK,) to detach the cells ...
-
bioRxiv - Neuroscience 2023Quote: ... 15-20 pooled day 30 neurospheres and 5-7 pooled day 60 organoids using TRIzol (Invitrogen; Thermo Fisher Scientific Inc., Waltham, MA, USA) and Direct-Zol RNA Mini Prep (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/ml blasticidin (Invitrogen) and 200 μg/ml zeocin (Invivogen ...
-
bioRxiv - Immunology 2021Quote: ... 5% penicillin-streptomycin (PenStrep, Gibco), 1x MEM non-essential amino acids solution ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5% FBS (Gibco, 16140-071) + 1% Pen-Strep (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% FCS (Gibco), 25 nM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mM EDTA (ThermoFisher Scientific) at 37 °C for 20 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 µL SuperaseIN (Invitrogen) in 100 µL total volume at 37 °C for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... 5% AA (Gibco® MEM), Non-Essential Amino Acids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 µg/ml fibronectin (Invitrogen) was added during overnight ligand incubation to promote cardiomyocyte attachment to the tissue culture surfaces.
-
bioRxiv - Neuroscience 2019Quote: ... containing DRAQ-5 (Thermo Fisher, 62251 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Cancer Biology 2019Quote: 5 μM MitoSOX Red (Invitrogen) was added to cells in HBSS for 30 min followed by washing ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... supplemented with 5% FBS (Gibco), 2 mM L-Glutamine (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... containing 5% FBS (Gibco, 26140079) and 10mM EDTA ...
-
bioRxiv - Pathology 2020Quote: DRAQ-5 (Thermo Fisher, 62251) was used at a dilution of 1:500 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 5% heat inactivated FBS (Gibco) and penicillin-streptomycin (100 units/mL ...
-
bioRxiv - Cell Biology 2019Quote: ... with 5% Horse serum (Invitrogen), 20ng/ml EGF (Peprotech) ...
-
bioRxiv - Bioengineering 2021Quote: ... containing 5% FBS (Gibco 16000069) and 2% B27 (Gibco A1895601) ...