Labshake search
Citations for Thermo Fisher :
9251 - 9300 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... on a QuantStudio 3 Real-time PCR System (Thermo Fisher Scientific, Inc., USA). To quantify P ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2021Quote: ... followed by DNA staining with 1 µM TOPRO-3 iodide (642/661; Invitrogen) and staining of the fungal hyphae with 100 μg/ml Fluorescent Brightener 28 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transduced cells were selected with Blasticidin (3 μg/ml) (Gibco, Cat. A11139-03) and Puromycin (1.5 μg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by TEV cleavage using 3 ul of AcTEV protease (Invitrogen, # 12575-015) in 160 ul of TEV cleavage buffer with constant rotation at 16°C for 90 minutes ...
-
bioRxiv - Physiology 2021Quote: ... TO-PRO-3 Cy5 was obtained from Molecular Probes (ThermoFisher, Grand Island, NY). Immunolabeled tissues were mounted in mounting medium (Vector Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... At DIV 3 the medium was changed to Neurobasal medium (Thermo Fisher Scientific) supplemented with B-27 (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Cdc7-HA were resolved on 3-8% Tris-Acetate gels (Invitrogen EA0375) at 150V for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... and blocking solution (PBS with 0.1% triton, 3% normal donkey serum; Fisher Scientific). Immunohistochemical and immunofluorescent staining ...
-
bioRxiv - Immunology 2020Quote: ... 4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY™-C16, Invitrogen, 1μM, 30min) or kynurenine (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... A PGC LC column (3 μm, 100 mm × 0.18 mm, Hypercarb, Thermo Scientific) was maintained at room temperature and at 50°C ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed 3 times with hepatocyte wash medium (Thermo Fisher Scientific, 17704024). Cells were then plated in a 6-well plate precoated with collagen I (50μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... Cell cultures at 3 × 106/ml were transiently transfected using Expifectamine (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... The concentration of total RNA was measured with a Qubit 3 fluorometer (Invitrogen). Synthesis and amplification of cDNAs with 1 ng of purified total RNA was performed as previously described (Nakamura et al ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was amplified on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were treated with DAPI (1:500, 3 min RT, ThermoFisher Scientific, D1306), washed briefly in PBS (2x) ...
-
bioRxiv - Neuroscience 2022Quote: ... on a QuantStudio 3 real-time PCR system (Applied Biosystems Cat. No A28567). The ΔΔCt method was used to determine the relative expression of mRNAs ...
-
bioRxiv - Immunology 2019Quote: ... FACS buffer was prepared by mixing 3% heat inactivated FBS with DPBS (Gibco).
-
bioRxiv - Cell Biology 2019Quote: ... Isolated sporozoites in RPMI 1640 containing 3% bovine serum albumin (BSA, Fisher Scientific) were pelleted (5 min ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were starved for 3 hours in serum free medium (OptiMEM®; Invitrogen). VEGF was then added to a final concentration of 30 ng/ml ...
-
bioRxiv - Developmental Biology 2019Quote: ... EphB1/3 – Alexa Fluor 488 Goat anti-Rabbit 488 (A-11008, ThermoFisher Scientific), HNK-1 – Alexa Fluor 647 Goat anti-Mouse IgM (A-21238 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were run on 3-12% gradient non-reducing acrylamide gels (Life Technologies). For complex I activity assay ...
-
bioRxiv - Developmental Biology 2019Quote: ... After 2-3 days cells were harvested with Trizol (Invitrogen, Carlsbad, CA, USA) for RNA-seq study.
-
bioRxiv - Cell Biology 2019Quote: Calcium transient was measured with Rhod-3 Calcium Imaging Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 6 ug RNA was treated with 3 units of Turbo DNase I (Invitrogen) for 45 min at 37 °C ...
-
bioRxiv - Bioengineering 2019Quote: ... and 3 μg/mL of amphotericin B (Gibco Laboratories, Grand Island, NY, USA).
-
bioRxiv - Bioengineering 2020Quote: ... and 3% (v/v) GlycoBlue co-precipitant (15mg/mL blue glycogen, Applied Biosystems). GlycoBlue was included in the complete lysis buffer as a hydrophilic carrier particle which associates with nucleic acids released during sample extraction ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Texas Red 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (DHPE-TexasRed) was from Invitrogen.
-
bioRxiv - Cell Biology 2020Quote: ... VIM (Hs00958111_m1) and glyceraldeyde-3-phosphate dehydrogenase (GAPDH) (Hs02758991_g1) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Thermocycling was performed in a real-time qPCR machine (QuantStudio 3, Applied Biosystems): 1 cycle for 30 min at 60 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were stained with the Hema 3 stat pack (Fisher Scientific #23-123869) and images captured with a Nikon Eclipse E200 microscope equipped with an Infinity 2 color camera (Lumenera ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were stained with TO-PRO-3 (Topro, Invitrogen, T3605; 1:3000 dilution).
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed for 3 times and incubated with FxCycleTM Violet Stain (ThermoFisher). The positive/negative gates for MCM were gated on a negative control ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was performed in QuantStudio 3 (Applied Biosystems, Waltham, MA, USA) with the following settings ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed on QuantStudio 3 Real-Time PCR Systems (ThermoFisher Scientific, USA). Each 20 μL of PCR mixture contained 10μl of TB Green Premix Ex Taq (Ti RNaseH Plus ...
-
bioRxiv - Neuroscience 2021Quote: ... At DIV 3 the medium was changed to Neurobasal medium (Thermo Fisher Scientific) supplemented with Forskolin (10 μM ...
-
bioRxiv - Immunology 2019Quote: ... 1µM of membrane impermeant fluorescent DNA binding probe TO-PRO®-3 (ThermoFisher) was also added to the culture medium ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and buffer exchanged 3 times with PBS pH7,4 (Cat # 10010023 Gibco, Waltham, MA) before concentrating down to 3 mL.
-
bioRxiv - Plant Biology 2021Quote: ... and 250 nM of gene-specific primers in QuantStudio 3 machine (Thermo Scientific). To calculate log2 fold change in treated and mock samples ...
-
bioRxiv - Molecular Biology 2020Quote: Run the reactions on a QuantStudio™ 3 real-time PCR machine (ThermoFisher) using the following program:
-
bioRxiv - Genomics 2019Quote: ... Proteins were separated on NuPAGE 3-8% Tris-Acetate Protein Gels (Thermo Fisher). The primary antibodies used were mouse anti-CAS9 (7A9-3A3 ...
-
bioRxiv - Pathology 2021Quote: ... Membranes were blocked for 1 hour at RT with 3% BSA (Thermo Fisher) in tris-buffered saline with 0,1% Tween (TBS-T ...
-
bioRxiv - Neuroscience 2019Quote: bEnd.3 (CRL-2299, ATCC) cells were cultured in DMEM (Gibco, 11995-065), supplemented with 2 mM L-glutamine (ThermoScientific ...
-
bioRxiv - Zoology 2020Quote: ... and then incubated with 3 μM AM ester Calcium Crimson TM dye (Invitrogen) for 30 min at 27°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Immunology 2021Quote: ... for clinical samples and on Quantastudio 3 Real-Time PCR System (Thermo Fisher) for HBECs.
-
bioRxiv - Microbiology 2021Quote: ... and the 3’ RACE System for Rapid Amplification of cDNA Ends (Life Technologies) were used according to manufacturer’s protocol ...