Labshake search
Citations for Thermo Fisher :
9151 - 9200 of 10000+ citations for 6 Methyl 2 Mercaptobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... supplemented with 1X N-2 supplement (Thermo Fisher, Cat#17502048), 1X B-27 supplement without vitamin A (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: Cells were grown in 2-well slide chambers (Fisher Scientific) and infected with virus ...
-
bioRxiv - Genomics 2022Quote: ... 3 μM CHIR99021 (Stemgent) and 0.5× N-2 Supplement (Gibco)) which was changed daily for the cells ...
-
bioRxiv - Systems Biology 2022Quote: ... and 2 ul of FastDigest SbfI (ThermoFisher cat. no. FD1194) in a total volume of 50 μl 1× ThermoFisher Green FastDigest Buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... The peptide (F2A(2-21)) was purchased from Thermo Fisher Scientific (Rockford ...
-
bioRxiv - Biochemistry 2022Quote: ... HCT116 and ES-2 were maintained in McCoy’s Medium (Gibco) containing 10% FBS (Gibco) ...
-
bioRxiv - Biophysics 2022Quote: ... 55 µM 2-mercaptoethanol (21985-023, Gibco / Thermo Fisher Scientific), and 10 % FCS (S1820 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-Mercaptoethanesulphonic Acid (MESNA) was purchased from Acros Organics (443150250). The primary antibodies used included anti-occludin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.6 µl and 2 µl of RNAiMAX in OPTIMEM (Gibco), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-human TRAIL (clone RIK-2, Thermofisher Scientific, Waltham, MA);Anti-hLAP or TGF beta 1 (MAB 246 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.1 mM 2-mercaptoethanol (Gibco, Cat. No. 21985-023)) with 1000 U/ml LIF (Chemicon ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 55 µM 2-mercaptoethanol (all from Thermo Fisher Scientific) at 37 ºC and 5% CO2 in a humidified incubator ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco). SK-N-SH and MNA Cells were maintained at 37 °C with 5% CO2.
-
bioRxiv - Immunology 2020Quote: ... The beads were harvested using a DynaMag-2 magnet (Thermofisher) and successively washed with 1XTBS-T containing 50 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Cathepsin L (Thermo Fisher Scientific, 33-2, BMS1032), rabbit anti-TGFBR1 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... diluted in PBS containing 2 μM Fluo4-AM (Thermo Fisher), incubated at 30°C for 30 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, cat. #E10415) was diluted 2.5 mg/ mL in sterile PBS and injected intraperitoneally on days 3 and 4 post-injury at a dose of 10 μL/ g body weight ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 ul of Turbo DNase (Thermo Fisher; Cat. No. AM2238) was added and incubated at 37 C for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and dispase (2 mg/mL, #17105041, Gibco, Grand Island, NY) over 40 min at 37°C with gentle shaking at 100 RPM ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 2 ml plating medium (Neurobasal medium (21103-049, Gibco) supplemented with 5% horse serum (H1270) ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse monoclonal anti-HA antibody (2-2.2.14, Thermo Fisher, #26183) diluted 1:104 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.02 mM 2-Mercaptoethanol (Thermo Fisher Scientific, Waltham, USA). Media2 consists of Neurobasal Media (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.02 mM 2-Mercaptoethanol (Thermo Fisher Scientific, Waltham, USA). Between d0 and d3 cells were kept in Media1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and painted with DiI (Thermofisher, 2 mg/mL in ethanol) for post-hoc track reconstruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 U of Dream Taq DNA polymerase (Thermo Scientific, USA), 5–10 ng of DNA template and nuclease-free water (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 10% FBS and 2-Mercaptoethanol (Gibco cat. 21985023) for 6 days ...
-
bioRxiv - Immunology 2021Quote: ... and 2 mM L-glutamine (Gibco, ThermoFisher Scientific, Waltham, USA). A second virus isolate (hCoV-19/Germany/ER1/2020 ...
-
bioRxiv - Immunology 2021Quote: ... and 2 mM L-glutamine (Gibco, ThermoFisher Scientific, Waltham, USA). A second virus isolate (hCoV-19/Germany/ER1/2020 ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... by injection of 2 µm-diameter fluorescent beads (F13083, ThermoFisher) and video recording (10 s ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2 µL 0.1 µM DTT (all from Invitrogen 18080044), with 1 µL RiboLock RNAse inhibitor (Thermo Scientific EO0382) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl of Lipofec-tamine® 2000 Transfection Reagent (ThermoFisher) and 2 μg of DNA plasmid were each diluted in 200 μl of Neurobasal™ media and incubated at room temperature for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... pulses = 2) using Neon Transfection system (Thermo Fisher Scientific, Singapore). After transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% heat- inactivated fetal bovine serum (FBS; Thermo Fisher #16000044) in a 120-rpm shaker at 34°C for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... supplemented with 2 U/mL Dispase II (Life Technologies, 17105041), 0.1 mg/mL Soybean Trypsin Inhibitor (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: Oocytes were fixed in 2% paraformaldehyde (ThermoFisher 50-980-487) diluted in PBS containing 0.1% Tween-20 (Sigma P1379-25ML ...
-
bioRxiv - Microbiology 2022Quote: ... or HPRT1 siRNA #2 (s6888) diluted in OptiMEM (Gibco, 31985070). RNA was harvested from cells 48 hpt knockdown validation by RT-qPCR ...
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added to the cells ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; Thermo Fisher Scientific, Waltham, MA) was either injected i.p ...
-
bioRxiv - Physiology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 antigens were biotinylated using EDC (Thermo Fisher) and Sulfo-NHS-LCLC biotin (Thermo Fisher ...
-
bioRxiv - Genetics 2022Quote: ... and 2 uL of 15 mg/mL GlycoBlue (ThermoFisher AM9515) were added before precipitating the RPFs in 150 uL 100% isopropanol overnight at -80 C ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-rat CD49d (Thermo Fisher MA49D7, clone TA-2), mouse anti-rat CD11a (Biolegend 201902 ...
-
bioRxiv - Immunology 2022Quote: ... blocked for 2 hr at RT with Elisa diluent (Invitrogen) (Ref ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed with 2% paraformaldehyde (PFA) (ThermoFisher, #43368-9M) and acquired on an Attune NxT flow cytometer ...
-
bioRxiv - Immunology 2022Quote: ... together with 2 μL 6x loading dye (Thermo Fisher Scientific). Electrophoresis was performed at 200 V for 35 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 2 - 5 μg/ml Puromycin Dihydrochloride (Thermo Fisher, # A1113803) until all negative control cells were dead ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 mM L-glutamine and 100U/ml penicillin/streptomycin (Gibco). All cell lines were cultured at 37℃ in a humidified 5% CO2 incubator ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 mM L- glutamine and 100U/ml penicillin/streptomycin (Gibco). MOLT4 (male ...