Labshake search
Citations for Thermo Fisher :
8501 - 8550 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2023Quote: ... The LC system was equipped with an Acclaim Pepmap nano-trap column (C18 PepMap100, 300 μm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) and an Acclaim Pepmap RSLC analytical column (C18 ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) using 0.1% [v/v] trifluoroacetic acid as mobile phase ...
-
bioRxiv - Plant Biology 2024Quote: Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 µm ID, 5 µm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 µl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Biochemistry 2024Quote: ... x 5 mm 5 μm 100 Å and an Acclaim PepMap RSLC 75 μm x 50 cm 2 μm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... whereas from July 2022 onwards loading was performed onto a new trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 20 µL/min over 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% (v/v) TFA in water and injected onto a C18 PepMap100-trapping column (0.3 × 5 mm, 5 µM, Thermo Fisher Scientific, Waltham, USA) coupled to a C18 analytical column packed in-house (75 µM × 300 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... The HPLC coupled to the LTQ Orbitrap XL was equipped with two PepMapTM C18 μ-precolumns (ID: 0.3 mm × 5 mm, 5 µm, 300 Å Thermo Fisher Scientific) and an AcclaimTM PepMapTM analytical column (ID ...
-
bioRxiv - Biochemistry 2024Quote: ... whereas from Jan 2022 onwards loading was performed onto a new trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 20 µL/min over 2 min ...
-
bioRxiv - Microbiology 2024Quote: Total RNA extracted from BoDV-2-infected Vero cells was ligated with either 5’ adaptor oligoRNA (5’-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA (Thermo Fisher Scientific, USA; #L150201)) or 3’ adaptor oligoRNA (5’-GAAGAGAAGGUGGAAAUGGCGUUUUGG ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were trapped on a C18 Acclaim PepMap 100 (5 μm, 300 μm x 5 mm) trap column (ThermoFisher Scientific, San Jose, USA) and eluted onto a C18 Acclaim PepMap100 3 μm ...
-
bioRxiv - Biochemistry 2024Quote: ... whereas from Jan 2022 onwards loading was performed onto a new trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 20 µL/min over 2 min ...
-
bioRxiv - Developmental Biology 2024Quote: Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Microbiology 2020Quote: ... Ultrathin sections of 50 nm were blocked with 5% fetal bovine serum/5% normal goat serum for 30 min and subsequently incubated with rabbit anti-GFP antibody (Life Technologies Corp., Eugene, OR) for 60 min at room temperature ...
-
bioRxiv - Systems Biology 2022Quote: Vector backbone was prepared by digesting 5 μg of CROPseq-CaptureSeq-Guide-Puro with 5 μl of FastDigest Esp3I (Thermo Scientific cat. no. FD0454) in a total volume of 50 μl 1× Thermo Scientific FastDigest Green Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... peptides were loaded on an Acclaim PepMap 100 μ-precolumn cartridge (5 μm, 100 Å, 300 μm ID x 5 mm, Thermo Fisher Scientific). Then ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... The 5 mL HisTrap column was washed with 10 column volumes of wash buffer (2× GIBCO 14200-075 PBS, 5 mM Imidazole, pH 7.5) followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... The tumor specimen was sectioned into 5×5 mm pieces under sterile conditions and coated in Matrigel (Cat No. 354234, Fisher Scientific, Waltham, MA, USA) to promote tumor take ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Bioengineering 2022Quote: ... All the cells were cultured at 37°C in 5% CO2 using 5 mL of Dulbecco modified Eagle medium (DMEM, Thermo Fisher Scientific, MA, USA)–high-glucose (4500 mg of D-glucose/liter ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Biochemistry 2019Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the precolumn ...
-
bioRxiv - Developmental Biology 2020Quote: The retinas of juveniles (n = 6 retinas from 5 animals) and adults (n = 5 retinas from 4 animals) were dissected out and put in RNAlater (Ambion Inc., Austin, TX, USA). RNA extraction was performed using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Ultrathin sections of 50 nm were blocked with 5% FBS/5% NGS for 30 min and subsequently incubated with rabbit anti-GFP (Life Technologies Corporation, Carlsbad, CA.)(1:200 ...
-
bioRxiv - Plant Biology 2022Quote: Replicate trials of soil grown grafted plants from 3-7 days post-grafting were cut at their root tips and dipped into (5 mg/mL) of 5(-and-6)-Carboxyfluorescein Diacetate (CFDA) (Invitrogen®, Waltham, MA, USA). Plants were incubated under full-spectrum LED lights (Cirrus LED Grow Lights ...
-
bioRxiv - Immunology 2024Quote: ... and OtsuR747 (5’- TATGCCTGAGTAAGATACGTGAATGGAATT-3’) primers (IDT, Coralville, IA) and detected with the probe OtsuPr665 (5’-6FAM- TGGGTAGCTTTGGTGGACCGATGTTTAATCT-TAMRA) (Applied Biosystems, Foster City, CA) by SsoAdvanced Universal Probes Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were trapped on a C18 trap column (Acclaim PepMap100 C18, 5 µm, 300 µm x 5 mm, Thermo Fisher Scientific, Waltham, MA) for 2 min before separation on an Easy-Spray™ C18 nano column (75 µm x 150 mm ...
-
bioRxiv - Genomics 2022Quote: ... the cells within explants were fluorescently labeled with 5 µg/mL of 5-chloromethylfluorescein diacetate (CellTracker™ Green; Thermo Fisher Scientific Inc., Waltham, MA) in serum-free media (DMEM with 1% PSF ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were washed with PBS 3-5 times for 5 minutes each and mounted with ProLong Gold Antifade Mountant (#P36930, Thermo Fisher Scientific, Waltham MA). Confocal images were taken with the 20x and 40x (oil ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Presence of active BMP signalling pathway was detected by an antibody against the phosphorylated form of Smad1/5/9 protein complex (Cell Signalling Technology, Cat#13802S) or pSmad1/5 (Thermo Fisher Scientific, Cat#700047) as indicated in figures ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were loaded on an Acclaim PepMap 100 μ-precolumn cartridge (5 μm, 100 Å, 300 μm ID x 5 mm, Thermo Fisher Scientific) and separated at 40°C on a PicoTip emitter (noncoated ...
-
bioRxiv - Biochemistry 2024Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the pre-column ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were intracardially perfused for 5 minutes with ice cold 1x DPBS followed by 5 minutes of ice cold 4% paraformaldehyde (PFA; Thermo Scientific, Fair Lawn, NJ). Following perfusion ...
-
bioRxiv - Microbiology 2024Quote: ... coupled to UltiMate 3000 LC system. Trap column µ-Precolumn C18 PepMap100 (5 µm, 300 µm, i.d. 5 mm, 100 Å) (Thermo Fisher Scientific, USA) and self-packed analytical column (Inertsil 2 µm ...
-
bioRxiv - Microbiology 2024Quote: ... and equipped with FAIMS Pro interface. Trap column μ-Precolumn C18 PepMap100 (5 μm, 300 μm, i.d. 5 mm, 100 Å) (Thermo Fisher Scientific, USA) and self-packed analytical column (Reprosil-Pur 3 μm ...
-
bioRxiv - Biophysics 2021Quote: ... 5% Fetal Calf Serum Heat Inactivated (FCS HI, Thermo Scientific) and 200μg/mL pennicilin/streptomycin (PS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... was supplemented with 5 mM HEPES (Life Technologies #15630-080), 100 U/mL penicillin/streptomycin (Life Technologies #1540-122) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a QuantStudio 5 Real-Time PCR System (Applied Biosystems), using manufacturer’ s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... or DRAQ5 (1:500; 5 min; RT; Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... During selection with 5 µg/ml blasticidin (Thermo Fisher A1113903), single clones were isolated ...
-
bioRxiv - Genetics 2021Quote: 5’ RACE was performed following manufacturer’s protocol (Invitrogen 18374-041) on total RNA harvested from WT and Rorbh1/h1 brain ...
-
bioRxiv - Genetics 2021Quote: ... with 5 μl of Lipofectamine RNAiMAX reagent (Invitrogen cat #13778) in 500 μl Opti-MEM I reduced serum medium (Invitrogen cat # 31985 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 μg/ml laminin-coated (Thermo Fisher Scientific, 23017015) four-well plates with coverslips ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% newborn calf serum (16010-159, Thermo Fisher Scientific). Human embryonic kidney 293T (HEK293T ...
-
bioRxiv - Microbiology 2019Quote: ... x 5 mm Acclaim PepMap µ-Precolumn (Thermo Fisher Scientific) and a 75 µm i.d ...
-
bioRxiv - Immunology 2020Quote: ... 5 % CO2 in a HERAcell 150i incubator (Thermo Fisher, USA).