Labshake search
Citations for Thermo Fisher :
8451 - 8500 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... using a trap-elute configuration with an Acclaim PepMap C18 (5 mm, 300 μm id, 5 μm particle diameter, 100 Å pore size) trap cartridge (Thermo Fisher Scientific). The gradient and LC parameters were the same for all analysis ...
-
bioRxiv - Systems Biology 2022Quote: ... Vector backbone was prepared by digesting and dephosphorylating 5 μg of CROPseq-CaptureSeq-Guide-Puro with 5 μl of FastDigest Esp3I (ThermoFisher cat. no. FD0454) and 2 μl of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher cat ...
-
bioRxiv - Biochemistry 2022Quote: ... Labeled peptides were first trapped on an Acclaim™ PepMap™ 100 C18 precolumn (5 μM, 0.3 mm X 5 mm, Thermo Fisher Scientific) and eluted to the analytical column nanoEase M/Z Peptide BEH C18 Column (130Å ...
-
bioRxiv - Molecular Biology 2020Quote: ... and shRNA plasmids or pCDH plasmids by PEI-40000 with the ratio of 5: 1: 5 in opti-MEM (Gibco, Thermo Fisher Scientific). Virions were collected after 48 h after transfection ...
-
bioRxiv - Plant Biology 2019Quote: Peptides were pre-concentrated and desalted for 3 min on a trap column (Acclaim PepMap 100, 300 µM × 5 mm, 5 µm particle size, 100 Å pore size, Thermo Fisher Scientific) using 2 % (v/v ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... The expression of SLC6A14/ATB0,+ was measured using specific forward/reverse primers (5’GCTGCTTGGTTTTGTTTCTCCTTGGTC3’ and 5’GCAATTAAAATGCCCCATCCAGCAC3’) and SYBR™ Green PCR Master Mix (Thermo Fisher Scientific); the amount of SLC22A5/OCTN2 and that of the housekeeping gene RPL15 (Ribosomal Protein Like 15 ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides originating from in-solution digestion of ROS preparations and HEK293 cell membranes were concentrated and desalted on a C18 precolumn (Acclaim PepMap, 300 μM * 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) with 0.1% TFA at a flow rate of 30 μl/min for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... Three microliters of each sample were loaded onto a C18 precolumn (C18 PepMap 100, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) with 15 μL/min solvent A (0.1% FA in H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... After a final wash (5 × 5 min), tissue was mounted with polyvinyl alcohol mounting medium (MilliporeSigma, Burlington, MA) and coverslipped (Thermo Scientific, Portsmouth NH).
-
bioRxiv - Pathology 2021Quote: ... in which the lac-operator and the ribosome binding site (RBS) were replaced by the 5’-UTR of the in vitro expression vector pEXP-5-CT/TOPO (Invitrogen, Karlsbad, CA, USA). For cloning ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were concentrated onto the trap column at 5 μL/min for 5 minutes and infused an Orbitrap Elite™ (Thermo Fisher Scientific). 120 minute gradients were run altering the buffer composition from 1% buffer B (80% ACN ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl of peptides solution was injected and concentrated on a μ-Precolumn Cartridge Acclaim PepMap 100 C18 (i.d. 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 10 μL/min and using solvent containing H2O/ACN/FA 98%/2%/0.1% ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... loaded on a trap column (C18 PepMap 100, 300 µM x 5 mm, 5 µm particle size, 100 Å pore size; Thermo Fisher Scientific) and desalted for 3 min at a flow rate of 15 µL min-1 using eluent A1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... x 5 mm 5 μm 100 Å and an Acclaim PepMap RSLC 75 μm x 50 cm 2 μm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Dionex) ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Pathology 2019Quote: ... The cells were maintained under standard cultural conditions at 37°C in an atmosphere of 5% CO2 and 5% O2 in a Heracell CO2 incubator (ThermoFisher Scientific, Waltham, MA) (28) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... we incubated 3x10[6] cells in 1ml Schneider’s Medium including 10% FBS for 5 min at 25°C with or without 5 µg/mL puromycin (Gibco™ Sterile Puromycin Dihydrochloride). Cells were then washed twice and incubated for 50 min at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... Phosphopeptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm, Thermo Scientific, MA, USA) and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Biochemistry 2019Quote: ... Short gradient LC method was adopted from the following technical note provided by the vendor (https://assets.thermofisher.com/TFS-Assets/CMD/Technical-Notes/tn-72827-lc-ms-tandem-capillary-flow-tn72827-en.pdf) with minor changes. Trap column μ-Precolumn C18 PepMap100 (5 μm, 300 μm, i.d. 5 mm, 100 A) (Thermo Fisher Scientific, USA) and self-packed analytical column (Inertsil 3 μm ...
-
bioRxiv - Neuroscience 2021Quote: ... mice were euthanized and both striata were dissected immediately and homogenized using a glass dounce homogenizer (5 loose and 5 tight strokes) in buffer A of mitochondria isolation buffer (ThermoFisher Scientific, no. 89874) and kept on ice for 2 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... Protein samples (12 μL) were mixed with 3 μL 5 M DTT and 5 μL 4x NuPAGE™ LDS sample buffer (Thermo Fisher Scientific) and incubated (95 °C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were desalted on a reversed-phase PepMap 100 C18 μ-precolumn (5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Fisher Scientific) before peptide separation on a nanoscale PepMap 100 C18 nanoLC column (3 μm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tryptic peptides were loaded onto a trap column (PepMap C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μL/min using 0.5% acetic acid (pH 4.5 with NH4OH ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µL of peptide solution was injected and concentrated on a µ-Precolumn Cartridge Acclaim PepMap 100 C18 (i.d. 5 mm, 5 mm, 100 Å, Thermo Fisher Scientific) at a flow rate of 10 mL/min and using solvent containing H2O/ACN/TFA 98%/2%/0.1% ...
-
bioRxiv - Molecular Biology 2022Quote: ... The HPLC coupled to the LTQ Orbitrap XL was equipped with two PepMapTM C18 μ-precolumns (ID: 0.3 mm × 5 mm, 5 µm, 300 Å Thermo Fisher Scientific) and an AcclaimTM PepMapTM analytical column (ID ...
-
bioRxiv - Biochemistry 2022Quote: ... as indicated in a trap and elute setting using an Acclaim™ PepMap™ 100 C18 trapping column (5 μM, 0.3 mm x 5 mm, Thermo Scientific™). All columns were operated at 50°C and connected to an EASY-Spray™ bullet emitter (10 μm ID ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were concentrated onto the trap column at 5 μL/min for 5 minutes and infused into an Orbitrap Elite™ (Thermo Fisher Scientific). 125-minute gradients were run altering the buffer composition from 2% buffer B (80% ACN ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2022Quote: Approximately 1 μg of peptides were loaded on a trap column (C18 PepMap 100, 300 μM × 5 mm, 5 μm particle size, 100 Å pore size; Thermo Fisher Scientific) using loading buffer (0.05% trifluoroacetic acid (TFA)/4% acetonitrile (ACN ...
-
bioRxiv - Immunology 2022Quote: To analyze cell morphology 5×104 cells were resuspended in 100mL PBS and cytocentrifuged onto slides at 350g for 5 minutes (Thermo Scientific, Cytospin 4) before fixation in methanol for 15 minutes and staining with May-Grünwald’s (VWR Chemicals ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 µg of peptides were first loaded on an Acclaim PepMap 100 μ-precolumn cartridge (5 μm, 100 A, 300 μm ID x 5 mm, Thermo Fisher Scientific) and were then separated at 40 °C on a PicoTip emitter (noncoated ...
-
bioRxiv - Cell Biology 2024Quote: ... one well was loaded with 5 µg of input mitochondria previously diluted in 5 µL of 2x LDS dye (Thermo Fisher Scientific, 84788) with 2.75 mM β-mercaptoethanol (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were washed 5 times for 5 minutes with PBS at room temperature and then exposed to Pierce ECL (Thermo Fisher Scientific, PI32106) for minutes ...
-
bioRxiv - Genetics 2023Quote: Mouse Embryonic Fibroblasts were obtained from E12.5 mouse embryos and expanded for 10 days at 37 °C with 5% CO2 and 5% O2 in DMEM medium (Thermo Fisher Scientific, 31966021) supplemented with 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Å pore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2023Quote: ... Phosphopeptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm, Thermo Scientific, MA, USA) and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 3.5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were loaded onto a C18 Acclaim™ PepMap™ trap column (100 Å, 5 μm × 0.3 mm × 5 mm, Thermo Fisher Scientific) and washed for 3 min at 30 μL/min before peptides were eluted onto a C18 Acclaim™ PepMap™ column (100 Å ...
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.