Labshake search
Citations for Thermo Fisher :
751 - 800 of 6633 citations for TMEM173 Human HEK293 Sumo His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... pH change experiment for oROS-HT-C199S were performed with HEK293s in PBS (10010001, Gibco) prepared at pH of 6 ...
-
bioRxiv - Biochemistry 2023Quote: ... HEK293 cells were incubated for 1.5 hours with glutamate-free DMEM GlutaMAX-I (Life Technologies), to reduce the extracellular concentration of glutamate ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Transient transfection of HEK293 cells by plasmid DNA was carried out by Lipofectamine 2000 (Invitrogen). The cells were replated 2 days after transfection and treated with 1 mg/mL G418 sulfate (EMD Chemicals Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293 cells were co-transfected with 200 ng of GeneArt CRISPR Nuclease mRNA (Invitrogen #A29378) in addition to sgRNA prepared by mixing fluorescently labelled Alt-R CRISPR-Cas9 tracrRNA ...
-
bioRxiv - Bioengineering 2024Quote: ... All other CYpHER molecules were produced by transient expression in suspension HEK293 cells (ThermoFisher GeneArt) and purified either via Ni-NTA pull-down as previously described (33 ...
-
bioRxiv - Biochemistry 2024Quote: ... HEK293/CRE-Luc/hCXCR4 cells were plated in Opti-MEM media (Invitrogen, cat# 31985-070) supplemented with 0.1% FBS (Seradigm ...
-
bioRxiv - Microbiology 2024Quote: ... and human (goat anti-human IgG, ThermoFisher) were also used ...
-
bioRxiv - Biophysics 2021Quote: ... 5% Fetal Calf Serum Heat Inactivated (FCS HI, Thermo Scientific) and 200μg/mL pennicilin/streptomycin (PS) ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into pcDNA3.1D/V5-His-TOPO (Thermo Fisher Scientific). MRC-5 cells were transfected with the SOD2-V5 expression construct using Polyethylenimine “MAX” (Polysciences Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 10% heat-inactivated fetal bovine serum (HI-FBS) (Gibco) at 37°C in the presence of 5% carbon dioxide (CO2) ...
-
bioRxiv - Bioengineering 2021Quote: ... The anti-His(C-term)-HRP antibody (R931-25, Invitrogen) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... cells resuspended in 500µl 2% HI-FBS + PBS (ThermoFisher 12484028), and passed through a 40µm nylon mesh cell strainer (FisherScientific 352235) ...
-
bioRxiv - Biochemistry 2020Quote: ... 6x-His tag Antibody (MA1-125 21315) was from ThermoFisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... for over-expression or pcDNA4/TO/myc-his-B (Thermofisher #V103020 ...
-
bioRxiv - Neuroscience 2020Quote: The backbone plasmid pcDNA6/V5-His was purchased from Invitrogen Inc ...
-
bioRxiv - Biophysics 2021Quote: ... 5% Fetal Calf Serum Heat Inactivated (FCS HI, Thermo Scientific) and 200μg/mL pennicilin/streptomycin (PS) ...
-
bioRxiv - Microbiology 2020Quote: ... Whole cell lysates were added to His beads (Thermo Scientific HisPur Ni-NTA Magnetic Beads ...
-
bioRxiv - Biophysics 2020Quote: ... 1 nM LanthaScreen Elite Tb-anti-HIS antibody (Thermo Fisher), and 400 nM FITC-labeled TRAP220 or NCoR peptide in a buffer consisting of 20mM potassium phosphate (pH 8) ...
-
bioRxiv - Biophysics 2020Quote: ... 1 nM LanthaScreen Elite Tb-anti-HIS antibody (Thermo Fisher), and 5 nM Fluormone Pan-PPAR Green fluorescent tracer ligand (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... we first placed ITPRIPL1 protein with 6x-His antibody (Invitrogen) first and slowly rotated at room temperature for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... An anti-His-tag antibody coupled to HRP (Thermo Scientific) was used for enzymatic detection ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1:10,000 dilution of mouse α-(6X)His (Invitrogen) primary antibody in PBST/3% BSA was applied for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... dissolved in 12μl of Hi-Di formamide (Thermo fisher, 4311320), denatured at 95°C for 5 mins followed by snapchill ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 10% heat-inactivated (HI)-FBS (Gibco, 10438-026), 100 ng/mL IL21 (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... All PCR reactions were performed using Hi-Fi Taq (Invitrogen) or Herculase II Fusion (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCR reactions were performed using Hi-Fi Taq (Invitrogen) with appropriate primers.
-
bioRxiv - Microbiology 2021Quote: ... 10% heat inactivated fetal bovine serum (HI-FBS; Life Technologies) and 1X penicillin/streptomycin (pen/strep ...
-
bioRxiv - Immunology 2020Quote: ... 1 mg of magnetic bead (Dynabeads™ His-Tag, Invitrogen) were coated with 70 μg of histidine tagged RBD ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... The Ion PI Hi-Q Sequencing 200 kit (Life Technologies) was used for all sequencing reactions and Torrent Suite™ Software 5.0 (Life Technologies ...
-
bioRxiv - Plant Biology 2022Quote: ... secondary anti-6x-His tag monoclonal antibody (Invitrogen, # MA1-21315) at 1:175 dilutions ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were cloned into pcDNA3.1/Myc-His(+) (Invitrogen). Full-length sequences of DBA and 129 IFI207 were obtained from the cloned cDNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Blue Mix Hi-ROX (PCR Biosystems) and StepOnePlus (Applied Biosystems). The data expressed as the ratio between the expression level of IL-6 mRNA and that of Actin ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cloned it in the pcDNA3.1/myc-His(-) plasmid (Invitrogen) in frame with a Myc-His tag to obtain the wild-type (WT ...
-
bioRxiv - Neuroscience 2023Quote: ... 6x-His Tag Monoclonal Antibody (HIS.H8) (MA1-21315, Thermo Scientific) and HRP-conjugated goat anti-mouse secondary antibody (Abcam ab6789-1 MG ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 5% heat inactivated Fetal bovine serum (HI-FBS) (Gibco). 1 million cells per 100 μl per sample were stained with anti-Flag antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... protein expression from plasmid (derivates of pBAD-His/B (Invitrogen) in all cases except expression of VirF from pCL5 [71] ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 nM LanthaScreen Elite Tb-anti-His antibody (ThermoFisher #PV5895), and 400 nM FITC-labeled PGC1α peptide in a buffer containing 20 mM potassium phosphate (pH 7.4) ...
-
bioRxiv - Biophysics 2023Quote: ... The medium was supplemented with 10% HI-FBS (Gibco, USA), 2 mM L-glutamine ...
-
bioRxiv - Biochemistry 2023Quote: ... bio-His-PADI4 was incubated with magnetic streptavidin beads (Invitrogen) (4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated with a 6x-His-Tag monoclonal antibody (Invitrogen) diluted 2500-fold in PBS-Tween overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... The anti-HIS antibody (MA1 21315) was purchased from Invitrogen.
-
bioRxiv - Bioengineering 2024Quote: Nitrocellulose transfers were stained with anti-His (Invitrogen PA1-983B), anti-SARS-CoV-S (Absolute Antibodies CR3022) ...
-
bioRxiv - Biophysics 2024Quote: 6x-His epitope tag antibody (His.H8) was purchased from Invitrogen. Monoclonal Flag M2 antibody (F1804-50UG) ...
-
bioRxiv - Biophysics 2024Quote: ... 7 mL of His-Pur Ni-NTA resin (Thermo Scientific) was equilibrated in Buffer A containing 40 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: ... The phosphorylation of SUMO-DsbR within the gel was detected by using a Pro-Q™ Diamond Phosphoprotein Gel Staining Kit (Invitrogen, catalog#: MPP33300) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: SUMO1 and SUMO2 SATT plasmids containing a SUMO E3 ligase of interest were generated using Gateway® cloning LR reaction (Thermo Fisher Scientific). LR reactions were performed using a donor plasmid containing an E3 enzyme cDNA without stop codon and a SATT plasmid as destination vector ...
-
bioRxiv - Immunology 2019Quote: ... Samples were prepared using the Ion PGM™ Hi-Q™ View OT2 and Ion PGM™ Hi-Q™ View Sequencing kits (ThermoFisher Scientific) and 4 barcoded libraries were combined per Ion 316™ Chip kit (ThermoFisher Scientific) ...
-
bioRxiv - Pathology 2022Quote: ... human CTRP3 (Invitrogen, PA5-115061, rabbit anti-human), α-SMA-Cy3 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... The GlnK1 gene was PCR-amplified using primers GlnK1_MM0732.for (5’ATGGTTGGCTATGAAATACGTAATTG3’) and GlnK1_MM0732.rev (5’TCAAATTGCCTCAGGTCCG3’) and cloned into pETSUMO by using the Champion™ pET SUMO Expression System (Thermo Fisher Scientific, Waltham, Massachusetts) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified recombinant plasmid DNA was digested with PacI and transfected into HEK293 cells with Lipofectamine (Invitrogen) according to manufacturer’s instructions ...