Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: The cDNA coding for fibulin1C (Uniprot number P23142-4) with a C-terminal 6x His tag was custom-synthesized by Invitrogen and transiently transfected in HEK293 T cells using polyethylenimine in OPTIMEM (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 NTD (residues 13-303) or RBD (residues 319-541) with a C-terminal His tag was cloned into a modified pFastBac vector (Invitrogen) that encodes a melittin signal peptide before the NTD or RBD ...
-
bioRxiv - Immunology 2020Quote: ... containing the gp67 secretion signal peptide and a C-terminal 6×His tag was inserted into pFastBac-Dual vectors (Invitrogen) and transformed into DH10Bac component cells ...
-
bioRxiv - Immunology 2022Quote: ... followed by an enterokinase cleavage site and a C-terminal double strep-tag was cloned into a modified pMT/BiP expression vector (pT350, Invitrogen). Drosophila S2 cells were stably co-transfected with pT350 and pCoPuro (for puromycin selection ...
-
bioRxiv - Biochemistry 2020Quote: ... the opsin-encoding constructs were fused in frame with a C-terminal 8-His tag and subcloned into the pPIC9K (A1ACR1, HfACR1 and AlACR2) or pPICZα (AlACR3) vector (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... constructs for dACE2 with C-terminal Myc-DDK and GFP tags cloned in pcDNA3.4 vector were custom-synthesized by Thermo Fisher. ACE2 with C-terminal GFP-tag (RG208442 ...
-
bioRxiv - Biophysics 2020Quote: ... with an N-terminal gp67 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFastBac-Dual vector (Invitrogen). The construct was transformed into bacterial DH10Bac component cells ...
-
bioRxiv - Cell Biology 2021Quote: The full-length cDNA of plexin-A2 was cloned into the gateway pDonor221 plasmid and then transferred by recombination into the pLenti6/V5-DEST lentiviral expression vector in frame with a C-terminal V5 tag according to the instructions of the manufacturer (Invitrogen), as previously described (Sabag et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... with a N-terminal FLAG-tag and a C-terminal 6×His-tag preceded by a two-residues linker were subcloned into pFastBac 1 vector (Gibco). Sequence transposition into bacmid DNA using DH10Bac cells (Gibco ...
-
bioRxiv - Biochemistry 2022Quote: ... elegans) containing a C-terminal His6-tag was cloned into the polyhedrin promotor site of the pFastBac DUAL vector (Invitrogen). Baculoviruses for respective constructs were produced by transfecting Sf9-cells (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... with a secretion sequence and C-terminal His6-tag) were transiently expressed using FreeStyle™ 293-F cells (Thermo Fisher) in FreeStyle™ F17 Expression Medium supplemented with L-glutamine and 1X MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... sE genes with a tandem C-terminal strep-tag in pMT/BIP/V5 plasmid were expressed in Drosophila S2 cells (Invitrogen) as described previously (20) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products of ame1 and okp1 point mutants (with C-terminal TAF tag and G418 marker) were amplified from the mutant plasmids using a high-fidelity DNA polymerase (SuperFi, Invitrogen) and transformed into the respective haploid ame1 and okp1 null mutants ...
-
bioRxiv - Evolutionary Biology 2023Quote: Codon-optimised sequences of Homo sapiens and Callithrix jacchus LEUTX with a GGGGSGGGGS linker and C-terminal V5 tag (Supplementary Figure S5) were synthesised by ThermoFisher GeneArt and cloned into a pcDNA3.1 mammalian expression vector ...
-
bioRxiv - Plant Biology 2023Quote: ... with a constitutive CaMV 35S promoter and either a YFP or CFP C-terminal tag using the LR Clonase II enzyme mix (Invitrogen). The YFP-tagged construct was used for the generation of stable transgenic Arabidopsis lines of and co-IP experiments ...
-
bioRxiv - Biophysics 2023Quote: ... and N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES) supplemented with 10% fetal bovine serum (FBS) (26140079, Gibco), 1% penicillin/streptomycin (15140122 ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells (Invitrogen) were grown in DMEM (1g/L glucose ...
-
bioRxiv - Synthetic Biology 2022Quote: HEK293 cells (ThermoFisher; further authenticated by assessing cell morphology and growth rate ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x N-2 (Life Technologies #17502-048), 1x B-27-RA (Life Technologies #12587-010) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x N-2 (Life Technologies #17502-048), 1x B-27-RA (Life Technologies #12587-010) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x N-2 (Life Technologies #17502-048), 1x B-27-RA (Life Technologies #12587-010) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1× N-2 supplement (Gibco, 17502-048), 2 μg/mL Doxycycline (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% (v/v) N-2 supplement (Gibco), 1x Glutamax (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... supplemented with 1X N-2 Supplement (ThermoFisher), 1 μg/mL Laminin (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% N-2 supplement (Gibco #17502-048), 1% MEM non-essential amino acid solution (NEAA ...
-
bioRxiv - Developmental Biology 2020Quote: ... N-2 supplement (1X, ThermoFisher, no.17502048), B-27 supplement (1X ...
-
bioRxiv - Synthetic Biology 2021Quote: ... containing 1X N-2 supplement (Gibco 17502048), 1X B-27 supplement (Gibco 17504044) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1x N-2 supplement (17502-048, Gibco), 10 ng/ml of recombinant murine Epidermal Growth Factor (EGF ...
-
bioRxiv - Neuroscience 2019Quote: ... 1x N-2 (Thermo Fisher Cat. 17502001), 1x Penicillin-Streptomycin (Thermo Fisher Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... N-2 Supplement (Gibco 17502-048, 1X) and human basic Fibroblast Growth Factor (bFGF ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 1 × N-2 supplement (Gibco), 1 × non-essential amino acid (NEAA ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% N-2 supplement (Invitrogen, Germany, EU) 200 Units/ml penicillin (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... 1x N-2 Supplement (Thermo Fisher Scientific), 1x B27 Supplement minus vitamin A (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% N-2 supplement (Gibco #17502-048), 1% MEM non-essential amino acid solution (NEAA ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5x N-2 supplement (Gibco # 17502-048), Glycogen synthase kinase 3 Inhibitor (GSK-Inhibitor ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1% N-2 Supplement (Life Technologies) were added ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 x N-2 (ThermoFisher 17502048) with and without SGC0946 ...
-
bioRxiv - Genetics 2019Quote: ... containing 1X N-2 supplement (Gibco 17502048), 1X B-27 supplement (Gibco 17504044) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1x N-2 supplement (Gibco, cat. 17502001), 20 ng/ml epidermal growth factor (PeproTech ...
-
bioRxiv - Genomics 2021Quote: ... 0.5× N-2 supplement (100× stock, Invitrogen), 20 ng/ml bFGF (Biolegend) ...
-
bioRxiv - Genomics 2021Quote: ... 0.5× N-2 supplement (100× stock, Invitrogen), 20 ng/ml bFGF (Biolegend) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% N-2 supplement (ThermoFisher #17502-048), 1% MEM non-essential amino acid solution (Sigma-Aldrich #M7145) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% N-2 Supplement (Thermo Fisher Scientific), 2% B-27 Supplement (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with N-2 (Gibco, 17502-048), 250 mg bovine serum albumin (BSA ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 x N-2 (ThermoFisher, 17502048) with and without SGC0946 ...
-
bioRxiv - Genomics 2022Quote: ... medium with 1x N-2 (Gibco, #17502048), 1x B-27 (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... 1X N-2 MAX Supplement (ThermoFisher, 17502048), 1X GlutaMAX Supplement (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 1X N-2 MAX Supplement (ThermoFisher, 17502048), and 1X GlutaMAX Supplement (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 1X N-2 MAX Supplement (ThermoFisher, 17502048), 1X GlutaMAX Supplement (ThermoFisher ...