Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for Recombinant Rabbit IFNB1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2.5 ng/mL recombinant human hepatocyte growth factor (Gibco, UK).
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... the membranes were probed with anti-TasA antibody (rabbit) used at a 1:20,000 dilution in Pierce Protein-Free (TBS) blocking buffer (ThermoFisher). For immunodtection of FloT-YFP ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-PRG-1 antibody (Custom) or rabbit IgG was pre-coupled to protein A/G matrix (Thermo Scientific, 88802) and incubated with the supernatant of worm lysates for 4 h (Anti-PRG-1 with N2 lysates ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyclonal anti-EhPKDL antibody used was raised in rabbit and subsequently purified with Protein A-Sepharose (Invitrogen, USA). Dilutions of antibody used were ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-H3K27Ac antibody or rabbit IgG antibody was conjugated to the Dynabeads™ protein G beads (Thermo Fisher Scientific). Chromatins (15 ug ...
-
bioRxiv - Immunology 2021Quote: ... IgG was purified from immunized rabbit serum using Pierce™ Protein A IgG Purification Kit (ThermoFisher, cat. No. 44667) and dialyzed against PBS ...
-
bioRxiv - Microbiology 2020Quote: ... 2µg rabbit anti-Msr1 IgG was cross-linked to 50µl of protein A/G agarose beads (ThermoFisher Cat# 20421) with dimethyl pimelimidate (ThermoFisher Cat# 21666) ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were visualized by incubation in 1 in 50,000 dilution of HRP-conjugated goat anti-rabbit IgG (Life Technologies) for one hour followed by Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... mouse monoclonal or anti-GFP rabbit polyclonal (ab290) antibody was incubated with Protein-G/A magnetic beads (Dynabeads, Invitrogen) in PBST for 2hrs at 4 °C ...
-
bioRxiv - Genomics 2021Quote: Co-IPs were performed with 200µg of nuclear protein extract that was pre-cleared with α-rabbit Dynabeads (Invitrogen) for 1 hour in IP buffer (20 mM Tris pH 8 ...
-
bioRxiv - Neuroscience 2022Quote: ... Sheared chromatin was incubated with anti-CEBPG or anti-rabbit IgG control antibody attached to protein A Dynabeads (Invitrogen) and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Detection of the specific protein signal was achieved by using WesternBreeze Chemiluminescent (anti-rabbit or anti-mouse) kit (Invitrogen) or by using Immobilon Forte Western HRP substrate (Merck)
-
bioRxiv - Microbiology 2024Quote: ... For the SARS-CoV-2 staining a polyclonal rabbit anti-SARS Coronavirus Spike protein (PA1-41142, Thermo Fisher, France) and revealed using an anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2024Quote: ... For protein detection secondary anti-mouse or anti-rabbit antibodies conjugated either to Alexa Fluor 488 and 555 (Invitrogen) for immunofluorescence or to horseradish peroxidase (HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... the slices were incubated with anti-green fluorescent protein rabbit IgG primary antibody (1:1000; Molecular Probes, OR, USA) and anti-Tyrosine Hydroxylase (TH ...
-
bioRxiv - Neuroscience 2021Quote: ... Chromatin antibody complexes were isolated using protein A-beads for rabbit primary antibodies or G-beads for mouse primary antibodies (Dynabeads, Invitrogen). The PCRs with 1:20 dilutions of genomic DNA (input ...
-
bioRxiv - Genetics 2020Quote: ... 10 cycles). Immunoprecipitation was performed using polyclonal rabbit anti-Mcd1p (a gift from V. Guacci) antibodies and protein A Dynabeads (Invitrogen).
-
bioRxiv - Cell Biology 2021Quote: ... Each protein of interest was then detected with HRP-conjugated goat anti-rabbit or anti-mouse IgG antibody (1:2000; Invitrogen), and visualized using SuperSignal West Pico PLUS Chemiluminescent Substrate or SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: Immunohistochemistry was performed using monoclonal antibodies directed to MV N protein (clone 83KKII, Chemicon [57]) or rabbit polyclonal antibody directed to GFP (Invitrogen). Goat anti-mouse IgG1 or goat anti-rabbit antibody conjugated with biotin was included as secondary antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mg of pre-cleared HeLa nuclear extracts were incubated overnight at 4°C with either 40 μg ATRX antibody or rabbit IgG cross-linked to Dynabeads Protein G (Invitrogen). Beads were washed three times with 5 ml wash buffer (20 mM HEPES ...
-
bioRxiv - Molecular Biology 2021Quote: ... For Protein A-tagged strains, immunoprecipitation was carried out with Rabbit IgG-conjugated (MP-Biomedicals, SKU 085594) Dynabeads (Invitrogen, 14301) as described 57 ...
-
bioRxiv - Genomics 2021Quote: ... A specific antibody or a total rabbit IgG control was added to the lysate along with Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... Trypsin gene expression levels were quantified by Q-PCR and trypsin protein was analyzed by Western Blot using rabbit polyclonal trypsin antibody (ThermoFisher).
-
bioRxiv - Developmental Biology 2022Quote: ... A specific antibody or a total rabbit IgG control was added to the lysate along with Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... and rabbit anti-H1.8 custom antibodies (26) (Identification# RU2130) were conjugated to Protein-A coupled Dynabeads (Thermo Fisher Scientific, # 10001D) at 250 μg/ml beads at 4 °C for overnight on a rotator ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purifications were carried out from 150 μl of the whole-cell extract (2 mg protein) per experiment using 37 µl of Dynabeads M-280 sheep anti-rabbit IgG (Invitrogen) and 2 µl of the anti-LytA antibody (Biomedal) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The horseradish peroxidase (HRP)-conjugated Protein A or HRP-conjugated rabbit anti-mouse secondary antibody for immunoblotting were from Invitrogen. The alpha smooth muscle actin (# ab7817) ...
-
bioRxiv - Immunology 2023Quote: ... The low and high molecular weight membranes proteins were incubated with respective primary antibodies (Rabbit anti-human BAIAP2L1, PA5-54000, Invitrogen) or (Goat anti-mouse GAPDH ...
-
bioRxiv - Microbiology 2023Quote: ... the membranes were incubated with an anti-TasA antibody (rabbit) at a 1:20,000 dilution in Pierce Protein-Free (TBS) blocking buffer (Thermo Fisher). A secondary anti-rabbit IgG antibody conjugated to horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... This was followed by overnight incubation with conjugated anti-green fluorescent protein (anti-GFP) rabbit antibody (1:2000; catalog no. A21311; Invitrogen). Finally ...
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant 6x-His tagged PTB was purified using Ni-NTA agarose (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...