Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for Recombinant Rabbit IFNB1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... containing 10 ng/ml recombinant human IL-2 (Gibco, Thermo Fisher), 10% heat-inactivated Fetal Calf Serum (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 10 ng/ml recombinant human IL-2 (Gibco, Thermo Fisher), 10% heat-inactivated Fetal Calf Serum (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant soluble ACE2 was coated on NUNC Maxisorp plates (Thermo Scientific) at 1µg/well at RT for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length recombinant human LRRK2[G2019S] was purchased from Invitrogen (#A15202). GZD-824 was purchased from Cayman Chemical (#21508 ...
-
bioRxiv - Biochemistry 2019Quote: ... The recombinant gene was cloned into pFastBac1 expression vector (Life Technologies) for bacmid production ...
-
bioRxiv - Cell Biology 2019Quote: Recombinant Bax was labeled by NBD dye (IANBD amide, Life Technologies) as reported previously (Kale et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 2.5 ng/mL of recombinant human IL-2 (Thermofisher, PHC0027). T-cells were co-cultured with the mCherry-Nucleus-7 MCF7 cells in the presence of CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher ...
-
bioRxiv - Genetics 2021Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 ng/mL of human recombinant epidermal growth factor (Invitrogen PHG0313), 10 ng/mL of basic fibroblast growth factor (Invitrogen PHG0263 ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with 5 ng/mL recombinant human interleukin 2 (Gibco, #PHC0027), 2 mM L-glutamine (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 2 ng/ml recombinant human FGF-Basic (Thermo Fisher Scientific) in a humidified incubator with 5% CO2 at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... the isolated recombinant EMBacY was transfected into adhesive Sf9 cells (Invitrogen) in 6-well plates ...
-
bioRxiv - Microbiology 2020Quote: Recombinant human mAbs were expressed in Expi293 HEK cells (Life Technologies), which were maintained in suspension at 37°C and 8% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1% human recombinant insulin and zinc solution (Gibco, 12585-014). On day 3 ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 U of recombinant Taq DNA Polymerase (Thermo Fisher Scientific, Lithuania) and water to final volume of 10μl ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and incubated on ice for 10 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Human recombinant fibroblast growth factor (human FGF2) (10 ng/ml, Invitrogen) was added to Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... and 1µl of RNaseOUTTM Recombinant Ribonuclease Inhibitor (Invitrogen, Catalogue no.-10777019). 11µl of the cocktail was added to the RNA/primer mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and the lysates were incubated on ice for 10 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... then treated with recombinant DNaseI (DNA-free DNA removal kit, Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human (h) PF4 was expressed in Drosophila Expression System (Invitrogen) S2 cells and purified as described22 ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant His-HMGB1 was produced in 293-freestyle cells (ThermoFisher Scientific). Purification of His-HMGB1 from 293-freestyle cell lysate was carried out using Ni SepharoseTM 6 Fast Flow gel (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 ng/mL recombinant human EGF (Thermo Fisher Scientific, Waltham, MA), 0.1 mM N-acetyl-L-cysteine (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: Purified recombinant human p38α (MAPK14, GST-tagged, Thermo Fisher Scientific, #PV3304), p38β (MAPK11 ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant soluble DPP4 was coated on NUNC Maxisorp plates (Thermo Scientific) at 100 ng/well at RT for 3 h ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were performed using Taq DNA Polymerase Recombinant kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 ng/mL thermostable recombinant human Fibroblast Growth Factor (Gibco)] unless otherwise noted ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.25 and 1 ng/ul human recombinant FGF8 (Thermofisher scientific, # PHG0184) diluted in E2 media by immersion starting at 18hpf ...
-
bioRxiv - Bioengineering 2021Quote: ... human recombinant insulin (10 μg ml-1, Life Technologies, 12585-014), IGF-2 (30 ng ml-1 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ng/ml mouse recombinant LIF (ES cell-tested) (Gibco #A35935). Upon reaching confluence ...
-
bioRxiv - Cell Biology 2022Quote: ... the recombinant GST-tagged kinase active human mTOR (Cat. PV4753, ThermoFisher) was used instead of the immunoprecitated mTORC1 ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...