Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for Recombinant Goat VEGFA Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant human EGF used in this study was from Thermo Fisher Scientific and the recombinant human HGF was generously provided by Drs ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... human recombinant EGF (10 ng/ml) (Thermo Fisher Scientific, Waltham, MA, USA), D-glucose (5.5 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human recombinant plasminogen activator inhibitor 1 (PAI-1) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA). The incubator condition was set at 37 °C with 5 % carbon dioxide environment ...
-
bioRxiv - Cell Biology 2023Quote: ... human recombinant fibroblast growth factor 2 (FGF2, 20 ng/mL, Life Technologies), and beta-mercaptoethanol (0.1% ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... bovine pituitary extract and human recombinant epidermal growth factor (Gibco, 37000-015)) and primary gingival keratinocyte (Dermal cell basal medium (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... hiPSCs were cultured on human recombinant vitronectin in StemFlexTM media (Life Technologies) and differentiation was initiated by plating singularised hiPSCs on human embryonic stem cells (hESC)-qualified Matrigel (Corning ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human IFN-β (1000 U/ml to 1 U/ml, ThermoFisher) was used as positive controls for IRF activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Neuroscience 2021Quote: ... The presence of secreted Fc Fusion protein in the medium was confirmed by immunoblotting with goat anti-human IgG antibody (Invitrogen, A-21433, 1:500).
-
bioRxiv - Developmental Biology 2022Quote: ... The presence of relevant proteins was visualized using Alexa Fluor secondary antibodies (donkey anti-mouse AF488, anti-rabbit AF555, A-31572, Thermofisher and anti-goat AF647).
-
bioRxiv - Cell Biology 2023Quote: ... immunoprecipitation of SRSF5-GFP was performed using a goat anti-GFP antibody (MPI-CBG, Dresden, Germany) coupled to Dynabeads™ Protein G (Thermo Fisher Scientific, 10002D). Co-purified ...
-
bioRxiv - Biochemistry 2024Quote: ... immunoprecipitation of Arid5a-GFP was performed using a goat anti-GFP antibody (MPI-CBG, Dresden, Germany) coupled to Dynabeads™ Protein G (Thermo Fisher Scientific, 10002D). Co-purified ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and the secondary antibodies goat anti-chicken-A488 and goat anti-rabbit-A546 (Invitrogen) at the relative dilutions of 1:250 and 1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... and AlexaFluor-647nm goat anti-mouse and goat anti-guinea pig (1:500; Invitrogen). Cells were then washed in PBS and mounted in Vectashield (Vector).
-
bioRxiv - Immunology 2019Quote: ... Alexa Fluor 488 goat anti-chicken and Alexa Fluor 568 goat anti-rabbit (Invitrogen) were used as secondary antibodies overnight at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: Appropriate Goat anti-Mouse and Goat anti-Rabbit Alexa Fluor® (Thermo Fisher Scientific) secondary antibodies 488 and 567 diluted 1:200 were incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Alexa Fluor-594 goat anti-rabbit and Alexa Fluor-488 goat anti-mouse (Invitrogen)
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-rabbit Alexa 488 and goat anti-mouse Alexa 488 (all from Invitrogen). DAPI (Sigma ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and incubated with secondary antibodies (Goat anti-mouse 555, Goat anti-rabbit 647 Invitrogen) overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-rabbit Alexa 568 and goat anti-guinea pig Alexa 647 (Molecular Probes). DAPI (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-rabbit Alexa 568 and goat anti-guinea pig Alexa 647 (Molecular Probes). DAPI (1:1000 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Further secondary antibodies (Goat α rabbit, life technologies; Goat α mouse/rat, Invitrogen; Alexa488) were blocked for 1h in FCS (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-mouse Alexa Fluor 488 and Goat anti-Rabbit Alexa Fluor 568 (Invitrogen) were used to detect bound primary antibodies.
-
bioRxiv - Neuroscience 2023Quote: ... goat α-rabbit and goat α-rat IgG secondary antibodies (Molecular Probes; Jackson Immunoresearch) were used at 1:500.
-
bioRxiv - Neuroscience 2023Quote: ... Alexa Fluor 647 goat anti-rabbit and Alexa Fluor 488 goat anti-mouse (Invitrogen) were used at a dilution of 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-mouse 680 (Invitrogen), goat anti-rabbit 800 (Invitrogen).
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-rabbit 800 (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... goat anti-rabbit IgG (Invitrogen).
-
bioRxiv - Genomics 2022Quote: ... goat anti-rabbit (Invitrogen #G21234).