Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for Recombinant Goat VEGFA Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... and 1µl of RNaseOUTTM Recombinant Ribonuclease Inhibitor (Invitrogen, Catalogue no.-10777019). 11µl of the cocktail was added to the RNA/primer mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and the lysates were incubated on ice for 10 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... then treated with recombinant DNaseI (DNA-free DNA removal kit, Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human (h) PF4 was expressed in Drosophila Expression System (Invitrogen) S2 cells and purified as described22 ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant His-HMGB1 was produced in 293-freestyle cells (ThermoFisher Scientific). Purification of His-HMGB1 from 293-freestyle cell lysate was carried out using Ni SepharoseTM 6 Fast Flow gel (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 ng/mL recombinant human EGF (Thermo Fisher Scientific, Waltham, MA), 0.1 mM N-acetyl-L-cysteine (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: Purified recombinant human p38α (MAPK14, GST-tagged, Thermo Fisher Scientific, #PV3304), p38β (MAPK11 ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant soluble DPP4 was coated on NUNC Maxisorp plates (Thermo Scientific) at 100 ng/well at RT for 3 h ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were performed using Taq DNA Polymerase Recombinant kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 ng/mL thermostable recombinant human Fibroblast Growth Factor (Gibco)] unless otherwise noted ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.25 and 1 ng/ul human recombinant FGF8 (Thermofisher scientific, # PHG0184) diluted in E2 media by immersion starting at 18hpf ...
-
bioRxiv - Bioengineering 2021Quote: ... human recombinant insulin (10 μg ml-1, Life Technologies, 12585-014), IGF-2 (30 ng ml-1 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ng/ml mouse recombinant LIF (ES cell-tested) (Gibco #A35935). Upon reaching confluence ...
-
bioRxiv - Cell Biology 2022Quote: ... the recombinant GST-tagged kinase active human mTOR (Cat. PV4753, ThermoFisher) was used instead of the immunoprecitated mTORC1 ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2.5 ng/mL recombinant human hepatocyte growth factor (Gibco, UK).
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Bioengineering 2022Quote: ... The secondary antibodies (goat anti-mouse Alexa Fluor 488, goat anti-rat Alexa Fluor 555, goat anti-rabbit Alexa Fluor 647; Invitrogen) were all prepared in 3% NGS in 1XPBS at a dilution of 1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... After washing with PBS guts were incubated with secondary antibodies (1:500 Goat anti-MouseAlexa647 [Invitrogen]; 1:500 Goat anti-RatAlexa647 [Invitrogen]; 1:500 Goat anti-RabbitAlexa647 [Invitrogen]) and DAPI (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... or fluorophore conjugated antibodies (Invitrogen, A32723, goat anti-mouse 488; Invitrogen, A21247, goat anti-rabbit 647; Invitrogen, A21206, goat anti-rabbit 488; Invitrogen, A21424 ...
-
bioRxiv - Developmental Biology 2020Quote: ... slices were incubated with different Alexa-488 goat anti-mouse IgG1 or 568 goat anti-mouse IgG2b or 568 goat anti-rabbit or 647 goat anti-guinea pig secondary antibodies (1:1000; Invitrogen) accordingly for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... washed in PBS and incubated 1h with 1:500 secondary antibodies (Alexa Donkey anti Goat 568 - A11057, Goat anti Mouse 568 - A11031, Goat anti Rabbit 555 -A27017; ThermoFisher). Nuclei were counterstained with 0.1µg/ml DAPI (D1306 ...
-
bioRxiv - Cell Biology 2022Quote: ... embryos were incubated for two hours at room temperature with fluorescently-labelled secondary antibodies diluted 1:100 in BBT (Alexa 488-conjugated goat anti-rabbit IgG, Alexa 555-conjugated goat anti-rat IgG, Alexa 647-conjugated goat anti-mouse IgG; Invitrogen). After five final washes in PBT ...