Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2% MEM Essential Amino Acids (ThermoFisher Scientific), 2% B27 (ThermoFisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... 2% non-essential amino acid solution (Gibco), 1 mM sodium pyruvate (Gibco) ...
-
bioRxiv - Biophysics 2024Quote: ... 2% non-essential amino acid solution (Gibco), and 1mM sodium pyruvate (Gibco).
-
bioRxiv - Molecular Biology 2023Quote: ... 2% B27 without retinoic acid (Life Technologies), 1% Glutamax (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% B-27 without retinoic acid (Gibco), 20ng/ml EGF (Prospec Bio) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2% MEM amino acid solutions (Gibco, 11140050) and 1mM Sodium pyruvate (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pellet was resuspended in 0.5 mL of NRB containing 6 μM 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher; D1306). The suspension was filtered through a 20 μm filter (Sysmex ...
-
bioRxiv - Neuroscience 2022Quote: ... and 12 old (21 months) male C57BL/6 animals (combined over 2 independent experiments) were intraperitoneally injected with 5-ethynyl-2’- deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in PBS at 5 mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... DNA and F-actin were counterstained for 20 min in the dark with 1 μL/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) and Alexa Fluor 647 phalloidin (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were washed three times with PBS and nuclei counterstained with 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI) (#D3571, Invitrogen) in PBS for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibodies were applied in incubation buffer (1:500 in PBS/BSA) with 4‘,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Doublets and dead cells were excluded based on forward scatter (FSC) and side scatter (SSC) and 4′,6-diamidino-2-phenylindole staining (DAPI, 1 µg/ml; ThermoFisher). All depicted flow cytometry plots were pre-gated on non-debris (by FSC and SSC) ...
-
bioRxiv - Microbiology 2021Quote: ... the cells were counterstained in 1 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific GmbH, Bremen, Germany) for 10 min at 46°C ...
-
bioRxiv - Microbiology 2022Quote: ... Enteroids were then washed with PBS three times with the addition of 4’,6-diamidino-2-phenylindole (DAPI) nuclear stain (1:5000) (Invitrogen) for the final 10 min wash ...
-
bioRxiv - Cell Biology 2024Quote: ... both at 1:300 dilution and mounted with ProLong Gold antifade reagent with DAPI (4’,6-diamidino-2-phenylindole; Invitrogen). Confocal microscopy (Olympus FLUOVIEW FV3000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and incubated with 0.1% Triton X-100 in PBS supplemented with 4′,6-diamidino-2-phenylindole (DAPI) (1 μg/ml) (Invitrogen, # 62248) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Slides were then washed and stained with 1:10,000 DAPI (4=,6-diamidino-2-phenylindole, Thermo Fisher Scientific; catalog #: D3571) for 15 minutes at room temperature before coverslips were applied using PBS + glycerol as mounting medium.
-
bioRxiv - Microbiology 2024Quote: ... blocked with 2% BSA in a PBS buffer for 10 min and incubated with 0.1–1 μg/ml DAPI (4’, 6-diamidyno-2-fenyloindol, Molecular Probes) and WGA-Texas Red (Wheat Germ Agglutinin-Texas Red ...
-
bioRxiv - Neuroscience 2024Quote: ... before incubation with DAPI (4’,6-diamidino-2-phenylindole, dilactate, 0.1 µg ml−1 final concentration in PB, Invitrogen D3571) in 0.1 M PB for 10–20 mins at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were washed again with PBST and incubated with 4′,6-diamidino-2-phenylindole (DAPI, Molecular Probes, 1:2000 dilution) and phalloidin-tetramethyl rhodamine B isothiocyanate (phalloidin-TRITC ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... Medium was changed every 2-3 days and cells were passaged every 3-4 days using Versene (ThermoFisher) and medium supplemented with Y-27623 ROCK inhibitor (Tocris) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 6 mM L-glutamine (2 mM, Gibco #31600-091 ...
-
bioRxiv - Microbiology 2020Quote: ... 6-di-amidino-2-phenylindole (DAPI; Invitrogen) on a glass slide ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) from ThermoFisher; anti-mouse IgG-horse radish peroxidase (HRP) ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... 6’-diamidino-2-phenylindole (DAPI; Life Technologies) diluted 1/10,000 for nuclei staining ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (ThermoFisher, #D1306) at a concentration of 10 µg/ml in PBS / 3.0%BSA for 15 minutes then rinsed 3x 5 minutes in distilled water ...
-
bioRxiv - Microbiology 2024Quote: ... 6’-diamidino-2-phenylindole (DAPI; Life Technologies) diluted 1:10000 in PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) to visualize nuclear DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Immunology 2023Quote: ... and 0.1% L-(tosylamindo-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Affymetrix, Cleveland, OH, USA). Lastly ...
-
bioRxiv - Microbiology 2021Quote: ... Gibco Hepes (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid, 0.05 mM; Invitrogen), ROCK Inhibitor Y-27632 (1 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... 5mM N-2-hydroxyethyl piperazine-N-2-ethane sulfonic acid (HEPES; Gibco, 15630080), and cOmplete ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, Gibco 15630080) and 1 % penicillin-streptomycin (PS ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 mM l-glutamine and 1% (wt/vol) nonessential amino acids (GIBCO). Medium was replaced with fresh medium every three days.
-
bioRxiv - Genetics 2024Quote: ... cell pellets were resuspended into PBS with 2% FBS and 1µg/ml of 4’,6-diamidino-2-phenylindol (DAPI) (Thermo Fisher Scientific, Cat#D1306) and transferred into 5 ml round bottom polystyrene flow tubes with cell strainer (Corning Life Sciences ...
-
bioRxiv - Immunology 2024Quote: ... 5×10-5 M 2-mercaptoethanol (Gibco) and 50µg/mL Gentamicin (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (5,000 cell/well) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (3,000 cell/well in 200 μL of complete medium and cultured under standard conditions for 48 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 7.4) containing 2 mM glucose for 2 hr with 100 nM of tetramethylrhodamine methyl ester (TMRM; Invitrogen, CA, USA). After the incubation ...
-
bioRxiv - Microbiology 2021Quote: ... 6- diamidino-2-phenylindole dihydrochloride (DAPI; Thermo Fisher D1306; 1:1,000 dilution) for 20 min ...
-
bioRxiv - Bioengineering 2024Quote: ... 6-diamidino-2 phenylindol (DAPI, 1 ug/mL; Thermo Fisher, Waltham, MA), and AlexaFluor 488 phalloidin (1:100 ...