Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Stromal transdifferentiation drives lymph node lipomatosis and induces extensive vascular remodelingbioRxiv - Pathology 2022Quote: ... For nuclear counterstaining the tissues incubated in 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen) for 5min and the slides were mounted with ProLongGold (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (0.1 mg/mL in PBS, Invitrogen, cat. D1306) was used to visualize nuclei ...
-
bioRxiv - Developmental Biology 2024Quote: ... The slides were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) and mounted ...
-
bioRxiv - Microbiology 2024Quote: ... Slides were mounted with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen, 100ng/ul) in VectaShield (Vector Labs ...
-
bioRxiv - Microbiology 2024Quote: ... Cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, 62248).
-
bioRxiv - Developmental Biology 2024Quote: ... samples were counterstained in 300 nM DAPI (4’,6-diamidino-2-phenylindole; D1306, ThermoFisher), and/or 20 μg ml-1 AlexaFluor 488-labeled peanut (Arachis hypogaea ...
-
bioRxiv - Pathology 2024Quote: ... The cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies). Cells were rinsed ...
-
bioRxiv - Developmental Biology 2024Quote: ... Medium was replaced daily from 8 hpf and supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Larvae were then kept at 28.5°C with fresh E3 medium supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics). Around 3-4 hours after heat-shock ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen). Slides were mounted in ProLong® Gold antifade reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) was used for nuclear counterstaining ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After PBS washing ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) nuclear stain ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen) and mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After washing slides were mounted in Elvanol ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... The relative expression of each target was calculated using the relative quantification method (2-ΔΔCT) with RNA18S (5’-TGTGGTGTTGAGGAAA-GCAG-3’ and 3’-TCCAGACCATTGGCTAGGAC-5’; Invitrogen) as internal control ...
-
bioRxiv - Physiology 2024Quote: ... 25 μM Cy5-hydrazide with 10 mM 2-amino-5-methoxybenzoic acid (ThermoFisher Scientific) in 1xPBS as a catalyst was added to the cells for 15 minutes at room temperature to allow complete conjugation with the aldehyde ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Bioengineering 2022Quote: ... 4-Chlorobenzenesulfonate Salt (DID) and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Invitrogen (Carlsbad, CA, USA). Ammonium bicarbonate ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were washed 4 times with PBST and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) at 1:1000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... Finally samples were counter stained for nucleus with 1 μM DAPI (4′, 6-diamidino-2′-phenylindoldihydrochloride; Thermo Fisher Scientific). Zeiss inverted Axio Observer fluorescent microscope (Zeiss ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Chromosomes were counterstained for 20 minutes with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; ThermoFisher Scientific, D3571) in 2x SSC ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:2000 LipidTOX was added along with 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) for 15 min ...
-
bioRxiv - Physiology 2023Quote: ... the sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI; D1306, Thermo Fisher Scientific; 1:1000 in PBS) for 2min at room temperature to counterstain the nucleus before being washed twice in PBS ...
-
bioRxiv - Plant Biology 2024Quote: DAPI (4′,6-diamidino-2-phenylindole) solution: Dilute 1 mg/ml DAPI (ThermoFisher, Cat. No. 62248, Rockford, IL, USA) to a final concentration of 0.5 µg/ml in 1x PBST (0.1% Tween-20).
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’ ,6-diamidino-2-phenylindole; cat. no. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’, 6-diamidino-2-phenylindole; Cat. No. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was then pegylated for 15 minutes with 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) before grids.
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2 phenylindole (DAPI, 1:10000, Fisher Scientific, catalog # EN62248). Microscope slides were cover slipped with Fluro-mount mounting media (Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... 20 mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, Gibco) and 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...