Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Cas9 as well as the flanking 5’ and 3’ nuclear localizing sequences and 5’-V5 tag from the GeneArt CRISPR Nuclease Vector (Thermo Fisher Scientific). HEK293-Cas9 cells were maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... All drug treatments were performed for 3 – 5 hours prior to imaging with a final concentration of 5 nM of actinomycin D (Gibco, 11805-017) or 1 µM of BMH-21 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: Epimastigotes and trypomastigotes lysates containing 2 x 107 parasites in 20 µL of SDS-PAGE sample buffer containing 5 mM DTT were boiled for 5 min and loaded onto precast Novex Value 4-12% Tris-Glycine gels (Thermo Fisher). The electrophoresis was performed in 50 mM MOPS-50 mM Tris Base ...
-
bioRxiv - Microbiology 2024Quote: ... then fixed in 4% PFA and stained with 5 μg/ml DAPI and 5 μg/ml CellMask Deep Red (Invitrogen C10046). Plates were imaged using the Opera Phenix high-content screening system ...
-
bioRxiv - Microbiology 2021Quote: ... and cells were incubated for 3 hours in minimal essential medium (MEM, Life Technology, Catalog # 11095114) supplemented with 1x MEM non-essential amino acids (Gibco) and 1x Antibiotic/Actinomycotic cocktail (Life Technology) ...
-
bioRxiv - Microbiology 2021Quote: ... a Nextera library was prepared and nucleic acid was quantified using the Qubit 3 Fluorometer (Thermo Fisher Scientific Waltham, MA). Samples were pooled for RNAsequencing of 4 nM of total cDNA and sequencing was performed using a NextSeq 500 Instrument (Illumina Inc San Diego ...
-
bioRxiv - Immunology 2022Quote: ... gels were rehydrated in 3% acetic acid and successively stained using Pro-Q Emerald 300 Lipopolysaccharide Gel Stain Kit (Invitrogen) and Coomassie Brilliant Blue R-250 ...
-
bioRxiv - Bioengineering 2023Quote: ... was reduced on the 78 ± 3 nm cores using 1 ml of 1 mM L-ascorbic acid (AA) (Fisher Scientific), making core@shell structures ...
-
bioRxiv - Immunology 2024Quote: ... Wells were developed by either 2,2’-azinobis(3-ethylbenzthiazolinesulfonic acid) (ABTS) substrate (KPL, Gaithersburg, MD) or ultra TMB-ELISA substrate solution (Thermo Scientific) at room temperature for 10 minutes and stopped by 1% SDS or 2 M H2SO4 respectively ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The nucleic acid concentration of each sample was measured using the QubitTM dsDNA HS kit on a QubitTM 3 Fluorometer (Invitrogen).
-
bioRxiv - Biochemistry 2024Quote: ... were resolubilized in 5µL 0.1% Formic acid and 3 µL was loaded onto a nano-Easy LC (Thermo Fisher Scientific) coupled to an Orbitrap Eclipse mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... A new rabbit serum was raised against mouse ninein, by cloning cDNA encoding mouse ninein (Uniprot Q61043-3, amino acids 1-496) into vector pRSET-A (Invitrogen), to produce a fusion protein with an amino-terminal hexa-histidine-tag ...
-
bioRxiv - Plant Biology 2022Quote: ... an additional cleaning step with acid phenol was added before precipitation of the RNA by adding an equal volume of Acid-Phenol:Chloroform 5:1 solution pH 4.5 (Ambion). Total RNA was quantified with a Nanodrop 2000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was stained with Sytox green nucleic acid stain (5 mM solution in DMSO from Thermo Fisher Scientific) and analyzed on a BD Accuri flow cytometer.
-
bioRxiv - Genetics 2020Quote: ... and in some cases day 5 (120 hours) by staining with SYBR Green 1 nucleic acid stain (Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... were harvested in an Eppendorf tube and resuspended in 0.5 mL NaCl (0.85%) containing SYTO9 green-fluorescent nucleic acid stain (5 nM final concentration, Invitrogen). Following incubation in the dark for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Peptides reconstituted with 5% acetonitrile/0.1% formic acid were quantified using Quantitative Colorimetric Peptide Assay (Thermo Fisher Scientific) and 10 µg of peptides for each sample were labeled with 50 µg of TMTpro16-plex reagents (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from gastrocnemius muscles of experimental mice (n=4 BC-PDOX; n=4 BC-PDOX PIO; n=3 NSC-Con) using Trizol (ThermoFisher Scientific, Waltham, MA, USA) and established methods21 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 g casamino acids (Gibco Bacto Casamino Acids, 223050), 0.5 g glucose (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was measured using a QuantStudio 3 or QuantStudio 5 qPCR machine (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... 5 × 106 cells were cultured in 3 ml Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... and then 3 hours at 37°C with 5 μg/mL mouse laminin (Thermo Fisher). Neurons are cultured in BrainPhys neuronal medium (Stemcell Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... Cells were disrupted by passing them 3-5 times through a French press (Thermo Fisher) and centrifuged for 50,000g for one hour at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 μL of a heavy-weight dextran (Invitrogen, Cat#D1818, 70,000 MW, lysine fixable) was injected into each juvenile octopus and allowed to circulate throughout the body for 5 minutes ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... and the cells resuspended in 3-5 mL of pancreatosphere medium (DMEM/F12 (Gibco, #11320033), 1% P/S ...
-
bioRxiv - Genetics 2024Quote: Cell pellets (1 x 10^5 – 3 x 10^6) were washed with PBS (Gibco), resuspended in RLB (10 mM Tris pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.5 mM aminocaproic acid and 30% sucrose) and loaded onto a 4-16% precast BN-PAGE gel (Life Technologies). Second dimension analysis was performed by solubilizing BN-PAGE gel slices in 2x Laemmli buffer (Laemmli ...
-
bioRxiv - Bioengineering 2022Quote: ... glacial acetic acid) for 2 hours at room temperature (Section 2.14) or methanol-free 4% formaldehyde (ThermoFisher, Section 2.16) and then kept in PBS at 4°C before washing in gradations of ethanol up to 100% ...
-
bioRxiv - Microbiology 2021Quote: ... Previously pelleted spheroplasts were resuspended in 1 mL 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer solution (Gibco) and 100 μl were collected as whole spheroplasts ...
-
bioRxiv - Microbiology 2020Quote: ... were quantified using an avidin and 4’-hydroxyazobenzene-2-carbocylic acid assay according to the manufacturer’s instructions (Fisher Scientific). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1,1’-bi(4-anilino) naphthalenesulfonic acid (Bis-ANS) and Alexa Fluor® 488 phalloidin were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2021Quote: ... The samples were acidified with 4 μL of 50 % formic acid and dried in a SpeedVac centrifugal evaporator (ThermoFisher) at 65°C for 2 h ...