Labshake search
Citations for Thermo Fisher :
7701 - 7750 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Clean-BlotTM IP Detection Kit (Thermo Fisher Scientific) was used to detect the bands of interest without the detection of denatured IgG as MFF protein size is close to both heavy and light chain ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Using the Lumio™ Green Detection Kit (ThermoFisher) as per manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... using an apoptosis detection kit (Life Technologies, V13241). For immunostaining ...
-
bioRxiv - Physiology 2024Quote: ... An ECL western blotting Detection kit (Thermo Scientific) was used for detection ...
-
bioRxiv - Physiology 2019Quote: ... qRT-PCR was performed using an ABI StepOnePlus Detection System (Applied Biosystems) with Brilliant III Ultra-Fast SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... PCR reaction performed using ABI Prism 7500 Sequence Detection System (Applied Biosystems).
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR was run on Quantstudio 3 detection system (Applied Biosystems, USA).
-
bioRxiv - Pathology 2022Quote: ... qRT-PCR was performed on a 7900HT Sequence Detection system (Applied Biosystems) using FastStart Universal SYBR Green Master kit (Roche Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed on a StepOne detection system (Thermo Fisher Scientific). Primer sequences are listed in the supplementary information (Table S4) ...
-
bioRxiv - Neuroscience 2023Quote: ... for mRNA detection or Taqman Universal PCR Master Mix (Thermo Fisher Scientific). Quantification cycle (Cq ...
-
bioRxiv - Cancer Biology 2021Quote: ... Q-RT-PCR was performed using TaqMan primers/probe sets (Applied Biosystems) and analyzed as transcript copies per 50 ng RNA expressed relative to RNAPII expression as previously described (33).
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SYBR green master mix (Applied Biosystems) on the Viia™ 7 Real-Time PCR system ...
-
bioRxiv - Cell Biology 2020Quote: ... The RT-PCR using the StepOne Plus (Life Technologies, Carlsbad, CA, USA) consisted of incubation at 50°C for 5 min followed by 40 cycles of 95°C for 15 s and of 60°C for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-PCR was carried out using Platinum™ Taq DNA Polymerase (Invitrogen) or Gotaq Master Mix (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: RT-PCR was conducted using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific). RNA molecules obtained ex vivo were used as templates ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: ... Quantitative RT-PCR was performed using SYBR® green fluorescent dye (Invitrogen). Specific Taqman probes were used for amplification of CD147 (forward 5’-GTCCAGGAAGTCAACTCCAA-3’ ...
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... RT-PCR reactions were performed using Superscript III reverse transcriptase (Life Technologies). For specific amplification of transgenic invadolysin ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR was performed with QuantStudio 5 (384 well format, Thermo Fisher) using FastStart Universal SYBR Green Master mix (Roche) ...
-
bioRxiv - Bioengineering 2021Quote: ... Quantitative RT-PCR was performed using SYBR Green (Applied Biosystems, Carlsbad, CA); the primers are listed in Supplementary Table 7 ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR were performed with TaqMan Gene Expression Assays (Applied Biosystems) on a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and used for RT-PCR amplification (Taq DNA Polymerase, Thermo Fisher Scientific). Amplification of 50 ng of cDNA was performed with the QuantiFast SYBR Green PCR Master Mix (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was done using SuperScript II reverse transcriptase (Thermo Fisher Scientific) and Expand high-fidelity PCR system (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... SuperScript III One-Step RT-PCR System (Thermo Fisher Scientific, Darmstadt, Germany) was used to perform reverse transcription PCR (RT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... and RT-PCR using the ABI 7700 cycler (Applied Biosystems, California, USA). rAAVs titers were between 109 - 1010 genomic copies/μl.
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative RT-PCR was performed using PowerUpTM SYBRTM Green Master mix (ThermoFisher) and QuantStudioTM 3 Real-Time PCR System (Applied Biosystem) ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were run using Applied Biosystems 7500 fast RT-PCR machine (Thermofisher) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific, catalog #: 11904018).
-
bioRxiv - Immunology 2019Quote: ... cDNA was synthesized by RT-PCR using oligo d(T) primer (Invitrogen) on a T100 thermal cycler (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative RT-PCR was performed with SYBR Green (Applied Biosystems ® 7500) using GAPDH as endogenous control ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed with a Mx3000 P system (Applied Biosystems) using SYBR® Premix Ex Taq™ II (TliRNaseH Plus ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT-PCR was performed using a SYBR Green master mix (Applied Biosystems) and samples run in triplicate with custom-designed primers.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription PCR was performed using SuperScript™ IV RT Mix (Invitrogen) and 2x Platinum™ SuperFi™ RT-PCR Master Mix (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... RT-PCR measurements employed the AMV reverse transcriptase system (Applied Biosystems 4368814) and Q-PCR reactions (7900HT Fast Real-Time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... using the SuperScript IV One-Step RT-PCR System (Thermo Fisher Scientific). Reactions were performed using a reverse transcription step at 50°C for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... using SuperScript™ III Platinum One-Step Quantitative RT-PCR System (Invitrogen) and primers and probe (Eurofins ...
-
bioRxiv - Microbiology 2021Quote: ... and RNA converted to cDNA using the ThermoScript RT-PCR system (ThermoFisher). Expression of mctA ...
-
bioRxiv - Microbiology 2021Quote: ... using the RNA UltraSense one-step quantitative RT-PCR system protocol (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription polymerase chain reaction (RT-PCR) (SuperScript IV enzyme (Thermo Scientific) followed by nested PCR (HotStarTaq Plus DNA Polymerase (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Quantitative RT-PCR was performed on a QuantStudio 3 System (Applied Biosystems) using the PowerUp SYBER Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-qPCR was performed using SYBR Green PCR Master Mix (Applied Biosystems). Primer sequences used for TMEMC8 were the following ...
-
bioRxiv - Cell Biology 2022Quote: ... All the qPCR and RT-PCR reagents were purchased from Thermo Scientific. Total RNA was reverse transcribed into cDNA by RT-PCR using High-Capacity cDNA Reverse Transcription Kit (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-PCR reaction was performed using custom TaqMan Array plates (ThermoFisher Scientific), pre-loaded with primers ...
-
bioRxiv - Physiology 2022Quote: ... on a QuantStudio 5 RT-PCR system (Applied Biosystems, Foster City, CA). Up to 48 libraries were sequenced per lane on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Plant Biology 2022Quote: ... on a QuantStudio 5 RT-PCR system (Applied Biosystems, Foster City, CA). Up to forty-eight libraries were sequenced per lane on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... RT-qPCR was performed using SYBR Green PCR master mix (Life Technologies). ACTB was used as the control for PCR product quantification and normalization ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was generated by RT-PCR with SuperScript IV reverse transcriptase (ThermoFisher) and primer 5’ TGGCGTCAGACTTTGAGAAGC 3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... elegans RNA using SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen). This PCR product was used as a transcription template to generate in vitro synthesized double stranded RNA using the MEGAscript RNAi Kit (Ambion) ...
-
bioRxiv - Genetics 2023Quote: ... and quantitative RT-PCR performed using SuperScript II Reverse Transcriptase (Life Technologies) and then a Takyon SYBR Green PCR kit (Eurogentec ...
-
bioRxiv - Pathology 2023Quote: ... using SuperScript™ IV first-strand synthesis system for RT-PCR (Invitrogen) with random hexamers (50 ng/μL) ...