Labshake search
Citations for Thermo Fisher :
7601 - 7650 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The beads were washed again with PBS using magnets and resuspended in 5% Pluronic F-68 (Gibco) PBS solution and incubated for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... HCT116 cells complemented with chromosomes 3 and 5 were cultured with 400 μg/mL geneticin (G418, Gibco) and 6 ug/mL blasticidine (Invivogen) ...
-
bioRxiv - Physiology 2022Quote: ... samples were sectioned transversely at 5 μm thickness using a HM325 manual rotary microtome (Thermo Fisher Scientific). H&E staining was processed with Varistain TM Gemini ES Automated Slide Stainer (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... Neurons were incubated with 5 μM Fura-2 AM and 0.04% Pluronic F-127 (Thermo Fisher Scientific) for 45-60 min at 37 °C in standard extracellular solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then washed thrice 5 min in PBS before incubation with Nissl NeuroTrace 530/615 (Invitrogen) at 1:200 (in 3%BSA/PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse (Y2H term reverse: 5’ GGAGACTTGACCAAACCTCTGGCG) primers using Phusion High-Fidelity PCR Kit from Thermo Scientific, with a standard PCR program.
-
bioRxiv - Molecular Biology 2020Quote: ... For qPCR 5–20 ng cDNA was mixed with the Fast SYBR Green Master mix (Applied Biosystems) and amplified with a Light-cycler (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... female) were grown at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) supplemented with 10% fetal bovine serum (EUROBIO) ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 37°C without aeration or in THY agar medium supplemented with 5% sheep blood (Thermo Scientific) at 37°C in a 5% CO2 atmosphere ...
-
bioRxiv - Immunology 2022Quote: ... pH6 for 5 minutes or by 10 minutes incubation with 5mg/ml proteinase K (ThermoFisher UK, #AM2548) at 37 degrees ...
-
bioRxiv - Microbiology 2021Quote: Hemolytic index was measured using 1.5% BHI agar plates supplemented with 5% defibrinated sheep blood (Thermo Scientific). After overnight incubation at 30°C ...
-
bioRxiv - Genomics 2020Quote: ... Protein was degraded by the addition of 5 μL of 20 mg/mL proteinase K (Invitrogen 25530049) and incubation at 50°C for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Genomics 2020Quote: ... Cells were stained with antibodies in a total volume of 100 μm PBS with 5% FBS (Gibco) for 30 minutes covered from light at 4°C and filtered into polypropylene FACS tubes (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: Human 293F cells were maintained at 37°C with 5% CO2 in FreeStyle 293 Expression Medium (ThermoFisher) supplemented with penicillin and streptomycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Staining of cells was performed using 5 μl of DiBAC4(3) (Invitrogen, 0.025 mg/ml in DMSO) followed by incubation for 15 minutes at room temperature in dark ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 30 minutes at 37°C (5 µM final concentration in insect medium) or H2DCFDA (Invitrogen #D399) at room temperature for 5 minutes (40 µM final concentration) ...
-
bioRxiv - Neuroscience 2020Quote: Samples (5–10 µg protein) were typically run on 4–12% Bis-Tris gels (Life Technologies; WG1403BOX10) using MOPS buffer (NP0001 ...
-
bioRxiv - Microbiology 2019Quote: ... samples were washed 3 times in PBS (5 min each time) and counterstained with SYTO9 (S34934, ThermoFisher). ProLong™ gold antifade mountant (Thermofisher ...
-
bioRxiv - Biochemistry 2020Quote: 5’ tsRNA-GluCUC was de-phosphorylated using 0.5 U/µg Fast-AP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific) in 1x Fast-AP Buffer for 12 minutes at 37°C followed by five minutes at 75°C ...
-
bioRxiv - Cell Biology 2019Quote: All cells were grown at 37°C and 5% CO2 and cultured in DMEM (Thermo Fisher Scientific) containing 1X GlutaMAX (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... Ligation was performed with 25 Weiss units of T4 DNA Ligase (5 U/μl, ThermoFisher Scientific #EL0011) for 20-24h at 16°C in reaction volumes of 100 μl supplemented with BSA (Thermo #AM2616 ...
-
bioRxiv - Genomics 2019Quote: ... and ACTB (Hs01060665_g1) were run in duplicate on the QuantStudio 5 Real-Time PCR System (Applied Biosystems). Relative APOL1 expression was calculated using the 2-ΔΔCT method ...
-
bioRxiv - Physiology 2019Quote: ... Cardiac perfusion with DiIC18(5)-DS (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine-5,5’-Disulfonic Acid; Thermo Fisher Scientific) diluted in 4% paraformaldehyde (PFA ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μg (otherwise noted) of terminally tagged and unmodified σ1R plasmid was transfected using lipofectamine 2000 (Invitrogen) for HEK 293T Δσ1R cells in a 10 cm plate ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 mM EDTA) was added to sample with and without 20 uL of RNaseA/T1 (Thermo Fisher) for 30 min at 37°C following sample rehydration ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were then treated with 5 μg/mL ultrapure Alexa-488 Fluor™ LPS (Life Technologies, L23351) or with non-fluorescent LPS (eBioscience™ ...
-
bioRxiv - Cell Biology 2019Quote: ... Ultramers were annealed by heating to 95°C for 5 minutes in Taq polymerase PCR buffer (Invitrogen) and allowing them to slowly cool to RT ...
-
bioRxiv - Systems Biology 2019Quote: LPS activated B-cells (5 million) were pulse labeled with EU (2.5 mM, Invitrogen Catalog No. C10365) for 30 minutes prior to harvesting at 72h post activation ...
-
bioRxiv - Immunology 2019Quote: ... cells were transfected with 5-20 ng/well of in vitro transcribed RNA using lipofectamine 2000 (Invitrogen). 24h after transfection ...
-
bioRxiv - Immunology 2019Quote: ... 5.106 cells were incubated for 15 minutes in PBS containing 5 µM CFDA succinimidyl ester (Molecular Probes). After washing ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... ATCC) were cultured at 37 °C with 5% CO2 in RPMI-1640 or DMEM media (Life Technologies) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5 μg/mL human recombinant laminin 521 (BioLamina #LN521-02) in E8 basal medium (Gibco #A1517001) supplemented with 1% Penicillin/Streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2020Quote: ... 200μl of sample was extracted with a 5:1 volume ratio of TRIzol LS (Ambion, Carlsbad, CA), utilizing standard manufacturers protocols and resuspending in 11μl water ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 µL of chromatide ChromaTide™ Alexa Fluor™ 488-5-UTP or 546-14-UTP (Thermofisher) were added to transcription reactions to fluorescently trace label mRNAs ...
-
bioRxiv - Molecular Biology 2020Quote: ... incubated at 37°C with 5% CO2 in a humidified cell incubator (Thermo Fisher Scientific; OH, USA). The plasmid pX330 carrying CRISPR/Cas9 system was kindly provided by Dr ...
-
bioRxiv - Genetics 2020Quote: Total RNA was extracted from 10 silkworm antennae from 5 males per genotype using Trizol reagent (Invitrogen) and treated with RNase-free DNAse I (Ambion) ...
-
bioRxiv - Immunology 2019Quote: ... Real time PCR analysis was performed using StepOne and QuantStudio 5 Real-Time PCR systems (Applied Biosystems). Hprt ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked with 5% milk in PBS supplemented with 1µl/ml Tween-20 (Thermo Fisher Scientific) for 1 hour at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... 5’-6FAM-AGC CTA CCT TGA CAA GCA ATC AGA CAC TCA A-MGB-3’ (Life Technologies). ZIKV HD78788 ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated with 5 µg/ml Alexa488- or Alexa568-conjugated transferrin (Tf) (Molecular Probes, T13342 and T23365) for 5 min ...
-
bioRxiv - Cell Biology 2019Quote: Changes in Ca2+ concentration in sperm cytoplasm were detected using 5 μM calcium indicator Fluo4-AM (Invitrogen) containing 0.1% Pluronic-acid F-127 and incubated at 37 °C under 6% CO2 in humidified air for 30 min in the dark 57 ...
-
bioRxiv - Cell Biology 2021Quote: ... medium was replaced 24–48 h after infection and 100 µg/ml Hygromycin (Invitrogen, ant-hg-5) was added.
-
bioRxiv - Immunology 2021Quote: ... and blocked in PBS + 0.1% Tween-20 + 5% bovine serum albumin (BSA) (Sigma-Aldrich or Fisher Scientific). If needed ...
-
bioRxiv - Neuroscience 2021Quote: ... For SYBRTMGreen the reaction mixture consisted of 5 µl of qPCRBIO SYGreen Mix High ROX (Thermo Fisher), 2.5 µl (1.25 µM ...
-
bioRxiv - Systems Biology 2021Quote: ... Migrated LCs were extracted from epidermal explant sheets cultured in media (RPMI, Gibco, UK, 5% FBS, Invitrogen, UK ...
-
bioRxiv - Bioengineering 2021Quote: ... 5×105 THP-1 cells/ml were treated with 25 ng/ml phorbol myristate acetate (PMA, ThermoFisher) in RPMI 1640 with 10% FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 % w/v PNIPAAm-g-CS was prepared in NP differentiation medium containing high glucose DMEM (Gibco), 1 % FBS (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... The samples were denatured at 95°C for 5 minutes in 2X RNA Gel Loading Dye (ThermoFisher) and loaded onto 10% TBE-Urea gels (ThermoFisher) ...