Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was run using SYBR Green on an ABI ViiA7 real-time PCR system (Applied Biosystems), and results were normalized to the expression of an RPLP0 control primer set ...
-
bioRxiv - Bioengineering 2023Quote: ... RT-qPCR was performed on a Step One Plus Real-Time PCR System (Thermo Fisher Cat#43765592R) with QuantiTect SYBR Green PCR Kit (QIAGEN Cat#204145) ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR reactions and were performed on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). ELF1a was used as a reference gene to normalize transcript abundances ...
-
bioRxiv - Physiology 2024Quote: ... We performed RT-qPCR in a 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA) using TaqMan Fast Universal PCR Master Mix (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Taqman Real-Time PCR (Thermo Fisher Scientific) gene expression assays were run in technical duplicate to quantify expression on an Applied Biosystems QuantStudio™ 5 Real-Time PCR System ...
-
bioRxiv - Cell Biology 2020Quote: ... QuantStudio5 real-time PCR machine (Applied Biosystems) with four technical replicates per biological replicate ...
-
bioRxiv - Developmental Biology 2022Quote: ... StepOnePLUS Real-Time PCR System (Thermo Fisher) was used for qRT-PCR in 96 well plates format ...
-
bioRxiv - Cancer Biology 2022Quote: ... Real-time PCR (Applied Biosystems, #ViiA 7) was performed using the KAPA SYBR FAST qPCR master Mix (KAPA Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: Real-Time PCR System (Thermo Fisher Scientific). Primer oligonucleotides were synthesized by Sigma and are listed in Supplementary Table S1.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: TaqMan-based real-time PCR (Applied Biosystems) was also performed in a Step One Plus Detection System (Applied-Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and real-time quantitative PCR (Applied Biosystems), using a primer set for probing EGR1 mRNA (Table S1).
-
bioRxiv - Biochemistry 2023Quote: ... A QuantStudio Real-Time PCR System (ThermoFisher) thermocycler was used following standard cycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viia7 Real Time PCR System (Life Technologies) and software was used for PCR and analysis.
-
bioRxiv - Biochemistry 2023Quote: ... on StepOnePlus Real-Time PCR (Applied Biosystems).
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR was performed using the SYBR Green PCR Master Mix on a ViiA7 Real-time PCR system (ThermoFisher Scientific) according to manufacturer’s instructions with 3 biological replicates (embryos randomly selected from 3 clutches ...
-
bioRxiv - Cell Biology 2021Quote: ... was used for quantitative real-time PCR using either StepOne Plus Real-Time PCR system or Quant Studio 12K Flex Real-Time PCR Sytem thermocycler (Applied Biosystems). For each reaction technical duplicates and at least three biological replicates per experiment were performed ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real time-PCR (QRT-PCR) was run on a 7300 real-time PCR system (Applied Biosystems – Life Technologies, Carlsbad, CA). mRNA levels were normalized to 3 housekeeping genes ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real time-PCR (QRT-PCR) was run on a 7300 real-time PCR system (Applied Biosystems – Life Technologies, Carlsbad, CA). mRNA levels were normalized to 3 housekeeping genes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative-Real-Time-PCR (qRT-PCR) was performed in a 7500 Fast Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific) using TaqMan® Universal PCR Master Mix ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time PCR was performed using the StepOnePlus Real-Time PCR System and Power SYBR Green PCR Master Mix (Applied Biosystems). Relative liver parasite levels were quantified using the ΔΔCt method comparing levels of P ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time PCR was performed using the StepOnePlus Real-Time PCR System and Power SYBR Green PCR Master Mix (Applied Biosystems). Relative liver parasite levels were quantified using the ΔΔCt method comparing levels of P ...
-
bioRxiv - Plant Biology 2020Quote: ... quantitative real-time PCR (qRT-PCR) assays were performed in the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, USA) using TB Green Premix Ex Taq II (Takara ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative-Real-Time-PCR (qRT-PCR) was performed in a 7500 Fast Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific) using TaqMan® Universal PCR Master Mix ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCR (Q-PCR) analysis was performed using SYBR Green Real-time PCR Master Mix on a Real-Time PCR System (Applied Biosystems). The primer sequences utilized for the Q-PCR amplification are provided in the supplemental Table 2.
-
bioRxiv - Microbiology 2022Quote: ... 5’-/FAM/TCAAGGAACAACATTGCCAA/TAMRA/-3’) were examined by real-time RT-PCR using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813) and AriaMX (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... and quantified using SYBR Green Real-Time PCR Kit (Thermo Fisher Scientific). Gene-specific primer pairs are as follows ...
-
bioRxiv - Genomics 2023Quote: ... QuantStudio™ 5 Real Time Detection System (ThermoFisher Scientific, USA) using the qKAT protocol (Jiang et al ...
-
bioRxiv - Microbiology 2023Quote: Quantification of the N gene in the eluate was performed by real-time reverse-transcription (RT-qPCR) using SuperScript™ III Platinum™ One-Step Quantitative RT-PCR System (Invitrogen) as described previously with minor modifications (26) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Quiagen®) in an ABI PRISM 7500 Sequence Detection System (Applied Biosystems). Amplifications were carried out in 25 µL reaction mixtures containing 2× reaction mix buffer ...
-
bioRxiv - Bioengineering 2021Quote: All real-time RT-qPCR reagents were purchased from ThermoFisher. The TaqMan probes included ...
-
bioRxiv - Genetics 2022Quote: ... Real-time qPCR was performed on a 7900HT Fast Real-Time PCR System or QuantStudio 5 Real-Time PCR System (Applied Biosystems, MA) and analyzed using Sequence Detection System Software v.2.1 or QuantStudio Design and Analysis Software v.1.2 (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each cell line was transfected for 72 hours with 100 nM Pre-miR Precursor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion ...
-
bioRxiv - Cancer Biology 2020Quote: Capan-1 and Hs 766T were transfected for 72 hours with 100 nM Pre-miR Precursor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We performed Real Time quantitative PCR (RT-qPCR) on the Bio-Rad CFX connect Real-Time PCR instrument with SYBR™ Green PCR Master Mix (Thermo Fisher Scientific). We computed the fold changes of the target genes by normalizing to the two reference genes 16S rRNA gene and gyrA with against of their geometric mean81 ...
-
bioRxiv - Cancer Biology 2019Quote: ... was used for real time PCR and was performed and analyzed using Viia7 Real Time PCR System (Life Technologies) and software.
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative real-time PCR (qPCR) was performed on Step One Real-Time PCR System (Life Technologies Corporation, CA, USA), and AceQ qPCR SYBR Green Master Mix (Vazyme ...
-
bioRxiv - Cancer Biology 2021Quote: ... SYBR Green-based real-time quantitative PCR was performed in the StepOnePlus™ Real-Time PCR System (Applied Biosystems). Primers used in this study are listed in Supplementary Table 5.
-
bioRxiv - Microbiology 2021Quote: ... ZIKV RNA levels were determined by quantitative real-time PCR on a 7500 Real-time PCR system (Applied Biosystems). Viral burden was expressed on a log10 scale as viral RNA equivalents per g or per mL after comparison with a standard curve produced using the serial 10-fold dilutions of ZIKV RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... The real-time PCR was performed using Step one Plus real time PCR Assay (Applied Biosystems, Foster City, CA). All reactions were carried out using Power SYBR Green premix (Applied Biosystems).
-
bioRxiv - Pathology 2022Quote: ... Real-time PCR was performed in technical duplicate on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, 4376600) using the Power SYBR® Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Biochemistry 2019Quote: ... cDNA quantification was done by real-time PCR on an ViiA 7 real-time PCR system (Thermo Fisher Scientific) using Maxima SYBR Green/ROX qPCR Master Mix (K0222 ...
-
bioRxiv - Microbiology 2019Quote: ... Gene expression levels were determined by real-time qRT-PCR in a StepOne Real-time PCR System (Applied Biosystems) using the Mesa Blue qPCR Mastermix Plus for Sybr assay kit (Eurogentec) ...
-
bioRxiv - Pathology 2021Quote: ... Real-time PCR was performed in technical triplicate on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, 4376600) or on a BioRad CFX96 Real-Time System using the Power SYBR® Green PCR Master Mix (Applied Biosystems ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... Real time PCR analysis was performed using a Step One Plus real-time PCR system (Applied Biosystems, Life Technologies, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a 7900HT Fast Real Time PCR System or a Quant Studio 5 Real Time PCR System (Applied Biosystems) with the primers listed in Supplemental Table S1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Real-time PCR was performed for each sample using the StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific). β-actin (Actb ...
-
bioRxiv - Systems Biology 2023Quote: ... Relative transcript quantifications were done by real-time PCR on an ViiA 7 Real-Time PCR System (Thermo Fisher) using Maxima SYBR Green/ROX qPCR Master Mix (K0222 ...
-
bioRxiv - Cell Biology 2023Quote: ... The real-time PCR reactions were performed using the QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... Gene expression was determined by quantitative real-time PCR using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Relative gene expression was determined using ΔΔCT method ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... Real-time PCR was performed on samples in duplicate on an ABI 7900HT Real-Time PCR System (Applied Biosystems) or Eco Real-Time PCR System (Illumina ...