Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR was performed using the SYBR Green PCR Master Mix on a ViiA7 Real-time PCR system (ThermoFisher Scientific) according to manufacturer’s instructions with 3 biological replicates (embryos randomly selected from 3 clutches ...
-
bioRxiv - Cell Biology 2021Quote: ... was used for quantitative real-time PCR using either StepOne Plus Real-Time PCR system or Quant Studio 12K Flex Real-Time PCR Sytem thermocycler (Applied Biosystems). For each reaction technical duplicates and at least three biological replicates per experiment were performed ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real time-PCR (QRT-PCR) was run on a 7300 real-time PCR system (Applied Biosystems – Life Technologies, Carlsbad, CA). mRNA levels were normalized to 3 housekeeping genes ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real time-PCR (QRT-PCR) was run on a 7300 real-time PCR system (Applied Biosystems – Life Technologies, Carlsbad, CA). mRNA levels were normalized to 3 housekeeping genes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative-Real-Time-PCR (qRT-PCR) was performed in a 7500 Fast Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific) using TaqMan® Universal PCR Master Mix ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time PCR was performed using the StepOnePlus Real-Time PCR System and Power SYBR Green PCR Master Mix (Applied Biosystems). Relative liver parasite levels were quantified using the ΔΔCt method comparing levels of P ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time PCR was performed using the StepOnePlus Real-Time PCR System and Power SYBR Green PCR Master Mix (Applied Biosystems). Relative liver parasite levels were quantified using the ΔΔCt method comparing levels of P ...
-
bioRxiv - Plant Biology 2020Quote: ... quantitative real-time PCR (qRT-PCR) assays were performed in the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, USA) using TB Green Premix Ex Taq II (Takara ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative-Real-Time-PCR (qRT-PCR) was performed in a 7500 Fast Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific) using TaqMan® Universal PCR Master Mix ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCR (Q-PCR) analysis was performed using SYBR Green Real-time PCR Master Mix on a Real-Time PCR System (Applied Biosystems). The primer sequences utilized for the Q-PCR amplification are provided in the supplemental Table 2.
-
bioRxiv - Microbiology 2022Quote: ... 5’-/FAM/TCAAGGAACAACATTGCCAA/TAMRA/-3’) were examined by real-time RT-PCR using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813) and AriaMX (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... and quantified using SYBR Green Real-Time PCR Kit (Thermo Fisher Scientific). Gene-specific primer pairs are as follows ...
-
bioRxiv - Genomics 2023Quote: ... QuantStudio™ 5 Real Time Detection System (ThermoFisher Scientific, USA) using the qKAT protocol (Jiang et al ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Quiagen®) in an ABI PRISM 7500 Sequence Detection System (Applied Biosystems). Amplifications were carried out in 25 µL reaction mixtures containing 2× reaction mix buffer ...
-
bioRxiv - Microbiology 2023Quote: Quantification of the N gene in the eluate was performed by real-time reverse-transcription (RT-qPCR) using SuperScript™ III Platinum™ One-Step Quantitative RT-PCR System (Invitrogen) as described previously with minor modifications (26) ...
-
bioRxiv - Bioengineering 2021Quote: All real-time RT-qPCR reagents were purchased from ThermoFisher. The TaqMan probes included ...
-
bioRxiv - Genetics 2022Quote: ... Real-time qPCR was performed on a 7900HT Fast Real-Time PCR System or QuantStudio 5 Real-Time PCR System (Applied Biosystems, MA) and analyzed using Sequence Detection System Software v.2.1 or QuantStudio Design and Analysis Software v.1.2 (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We performed Real Time quantitative PCR (RT-qPCR) on the Bio-Rad CFX connect Real-Time PCR instrument with SYBR™ Green PCR Master Mix (Thermo Fisher Scientific). We computed the fold changes of the target genes by normalizing to the two reference genes 16S rRNA gene and gyrA with against of their geometric mean81 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each cell line was transfected for 72 hours with 100 nM Pre-miR Precursor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion ...
-
bioRxiv - Cancer Biology 2020Quote: Capan-1 and Hs 766T were transfected for 72 hours with 100 nM Pre-miR Precursor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion ...
-
bioRxiv - Cancer Biology 2019Quote: ... was used for real time PCR and was performed and analyzed using Viia7 Real Time PCR System (Life Technologies) and software.
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative real-time PCR (qPCR) was performed on Step One Real-Time PCR System (Life Technologies Corporation, CA, USA), and AceQ qPCR SYBR Green Master Mix (Vazyme ...
-
bioRxiv - Cancer Biology 2021Quote: ... SYBR Green-based real-time quantitative PCR was performed in the StepOnePlus™ Real-Time PCR System (Applied Biosystems). Primers used in this study are listed in Supplementary Table 5.
-
bioRxiv - Microbiology 2021Quote: ... ZIKV RNA levels were determined by quantitative real-time PCR on a 7500 Real-time PCR system (Applied Biosystems). Viral burden was expressed on a log10 scale as viral RNA equivalents per g or per mL after comparison with a standard curve produced using the serial 10-fold dilutions of ZIKV RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... The real-time PCR was performed using Step one Plus real time PCR Assay (Applied Biosystems, Foster City, CA). All reactions were carried out using Power SYBR Green premix (Applied Biosystems).
-
bioRxiv - Pathology 2022Quote: ... Real-time PCR was performed in technical duplicate on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, 4376600) using the Power SYBR® Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Biochemistry 2019Quote: ... cDNA quantification was done by real-time PCR on an ViiA 7 real-time PCR system (Thermo Fisher Scientific) using Maxima SYBR Green/ROX qPCR Master Mix (K0222 ...
-
bioRxiv - Microbiology 2019Quote: ... Gene expression levels were determined by real-time qRT-PCR in a StepOne Real-time PCR System (Applied Biosystems) using the Mesa Blue qPCR Mastermix Plus for Sybr assay kit (Eurogentec) ...
-
bioRxiv - Pathology 2021Quote: ... Real-time PCR was performed in technical triplicate on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, 4376600) or on a BioRad CFX96 Real-Time System using the Power SYBR® Green PCR Master Mix (Applied Biosystems ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... Real time PCR analysis was performed using a Step One Plus real-time PCR system (Applied Biosystems, Life Technologies, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a 7900HT Fast Real Time PCR System or a Quant Studio 5 Real Time PCR System (Applied Biosystems) with the primers listed in Supplemental Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The Taqman real-time PCR was carried out using Applied Biosystems QuantStudio 7 Flex Real-Time PCR System (Thermofisher), and all the procedures were followed as per the instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... were used to perform real-time PCR on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Waltham, MA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Immunology 2023Quote: ... Real time quantitative PCR analysis was performed using a QuantStudio 3 real time PCR system (Applied Biosystems, Waltham, MA) using a Radiant qPCR mastermix (Alkali Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Real-time PCR was performed for each sample using the StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific). β-actin (Actb ...
-
bioRxiv - Cell Biology 2023Quote: ... The real-time PCR reactions were performed using the QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Systems Biology 2023Quote: ... Relative transcript quantifications were done by real-time PCR on an ViiA 7 Real-Time PCR System (Thermo Fisher) using Maxima SYBR Green/ROX qPCR Master Mix (K0222 ...
-
bioRxiv - Neuroscience 2023Quote: ... Gene expression was determined by quantitative real-time PCR using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Relative gene expression was determined using ΔΔCT method ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... Real-time PCR was performed on samples in duplicate on an ABI 7900HT Real-Time PCR System (Applied Biosystems) or Eco Real-Time PCR System (Illumina ...
-
bioRxiv - Synthetic Biology 2024Quote: The reaction was performed using a real-time PCR system (StepOnePlus Real-Time PCR System, Life Technologies, CA, USA) by incubating at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... A quantitative real-time PCR assay was performed on a 7500 real-time PCR system (Applied Biosystems, CA, USA) using iTaq Universal SYBR Green Supermix (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time PCR was carried out using an ABI Step One Plus Real-Time PCR System (Applied Biosystems). Reactions for each sample were performed in triplicate ...
-
bioRxiv - Neuroscience 2024Quote: A duplex real-time PCR (ABI Prism Step One real-time PCR apparatus, Thermo Fisher Scientific, Waltham, MA, USA) was performed in triplicates of 1:10 diluted cDNA samples with predesigned FAM-labeled TaqMan® assays (Applied biosystems by Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative RT-PCR was performed by real-time PCR in an ABI PRISM 7000 Sequence Detection System using SYBR green PCR Master Mix (Applied Biosystems). All PCR reactions were carried out in duplicates and carbonic anhydrase II was used as a normalisation control ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR was performed in an ABI PRISM 7000 Sequence Detection System using SYBR green PCR Master Mix (Applied Biosystems). All PCR reactions were carried out in duplicates using 3 ng Input or Bound DNA as template ...
-
bioRxiv - Cancer Biology 2020Quote: ... Aliquots of 5-fold diluted reverse transcription reactions were subjected to quantitative (q)PCR with KAPA SYBR FAST master mix using the Vii7 real time-PCR detection system (Applied Biosystems). GAPDH mRNA levels were measured for normalization ...
-
bioRxiv - Cancer Biology 2020Quote: ... PD-L1: Hs00204257_m1) for PCR amplification and detection on the HT Fast Real-Time PCR System (Applied Biosystems from Life Technologies). GAPDH was used as an endogenous normalization control ...
-
bioRxiv - Cancer Biology 2020Quote: ... PD-L1: Hs00204257_m1) for PCR amplification and detection on the HT Fast Real-Time PCR System (Applied Biosystems from Life Technologies). GAPDH was used as an endogenous normalization control ...
-
Molecular Basis of Sex Difference in Neuroprotection induced by Hypoxia Preconditioning in ZebrafishbioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR (qPCR) was performed in triplicates by using SYBR Green PCR Master Mix Detection System (Applied Biosystems, USA). Relative gene expression analysis was performed with β-actin as housekeeping gene.
-
bioRxiv - Physiology 2020Quote: ... Real-time PCR was performed on an ABI 7000 sequence detection system using POWER SYBR-Green PCR Master MIX (Applied Biosystems). Primers were purchased from IDT Technologies and sequences are shown in Table 1.