Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... Differentiation of confluent hSkMC-AB1190 myoblasts and hSkMC-AB1190-GLUT4 myoblasts was induced by incubating the cells in differentiation medium for 6 to 7 days: DMEM (Gibco), Gentamycin 50 µg/ml (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... of 0.5% low-melting agarose (FMC; Pignata et al., 2019) containing a 6:7 ratio of spinal cord medium (MEM with Glutamax (Gibco) supplemented with 4 mg/ml Albumax (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100-µl drop of 0.5% low-melting agarose (FMC, Fig. 1D,E, Fig. S1G) containing a 6:7 ratio of spinal cord medium [MEM with Glutamax (Gibco) supplemented with 4 mg/ml Albumax (Gibco) ...
-
Highly efficient homology-directed repair using transient CRISPR/Cpf1-geminiviral replicon in tomatobioRxiv - Molecular Biology 2019Quote: ... 2015) (Supplemental Table 6 and 7) junctions and a high-fidelity Taq DNA polymerase (Phusion Taq, Thermo Fisher Scientific, USA) and Sanger sequencing (Solgent ...
-
bioRxiv - Genetics 2021Quote: ... the PCR products from either primer pairs 6/7 or 9/10 with the plasmid vector pCR 2.1 (Thermo Fisher) followed by transformation of One Shot Top 10 chemically competent cells (Thermo Fisher ...
-
bioRxiv - Physiology 2023Quote: ... at 1,000g for 2min and then immediately loaded into the QuantStudio 6 and 7 Flex real-time PCR system (ThermoFisher Scientific). A two-step cycling protocol was implemented to collect cycle threshold (Ct ...
-
bioRxiv - Cell Biology 2023Quote: The ROS dye assay was performed using Di(Acetoxymethyl Ester) (6-Carboxy-2’,7’-Dichlorodihydrofluorescein Diacetate) ROS dye (Invitrogen, D23844), a fluorogenic dye that is converted to 6-CarboxyFluorescein ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3.6 x 106 HEK293T17 cells were transfected on a 6-well plate with 7 µl Lipofectamine 3000 (Thermo Fisher Scientific), the packaging plasmids psPax2 (3 µg ...
-
bioRxiv - Cancer Biology 2023Quote: ... following manufacturer’s protocols and gene expression quantified via Applied Biosystems Quant Studio 6/7 Real-Time PCR System (Applied Biosystems), for TaqMan (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... BHK-21 cells (7×105/well) were transfected in tissue culture-treated 6-well plates using Lipofectamine 2000 (ThermoFisher Scientific) with the LCMV Arm plasmids pCAGGS-NP (0.8 µg) ...
-
bioRxiv - Cell Biology 2022Quote: ... we used 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) or FxCycle™ PI/RNase Staining Solution (Thermofisher ...
-
bioRxiv - Genomics 2020Quote: ... 7-Aminoactinomycin D (7-AAD) (1:200 dilution, ThermoFisher Scientific #A1310 ...
-
bioRxiv - Neuroscience 2022Quote: ... 7-aminoactinomycin D (7-AAD, Thermo Fisher, A 1310) was added 1:50 as a cell death marker.
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Biochemistry 2019Quote: ... 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA; Molecular Probes, Eugene, OR, USA) was used to detect NO production in sorghum genotype stalks in response to inoculation treatment at 7 DPI ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 30 flies of 5-7 days old by TRIzol reagent (Invitrogen). The genomic template was removed using DNase (Takara) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cultures were passaged every 5 to 7 days with collagenase type IV (Invitrogen; 1 mg/mL). The identities of all parental hESC and hiPSC lines were confirmed by DNA fingerprinting and all cell lines were regularly tested to exclude mycoplasma contaminations using a PCR-based assay ...
-
bioRxiv - Immunology 2021Quote: ... Five minutes prior to analysis 5 μg/ml 7-amino actinomycin D (Life Technologies, CA, USA) was added for exclusion of dead cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were split every 5-7 days by incubation with 0.5 μM EDTA (Thermo Fisher Scientific) for 4 min at room temperature and clumps were dissociated into small clumps by pipetting ...
-
bioRxiv - Biochemistry 2023Quote: ... we incubated 5-7 μg of BACMID DNA with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 250 μL of Opti-MEM serum free media for 30 minutes at 23ºC ...
-
bioRxiv - Neuroscience 2023Quote: ... 15-20 pooled day 30 neurospheres and 5-7 pooled day 60 organoids using TRIzol (Invitrogen; Thermo Fisher Scientific Inc. ...
-
bioRxiv - Biochemistry 2023Quote: ... 7 mM NaOH) followed by an incubation of 5 hrs with Dynabeads Protein G (Invitrogen, 10004D). Beads were then washed with Wash Buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Developmental Biology 2024Quote: Cells were collected from one well of a 6-well plate using 700 µL of TRIzol Reagent (Life Technologies) and RNA was extracted using Direct-zol RNA Miniprep (Zymo Research) ...
-
bioRxiv - Microbiology 2020Quote: ... at 4 °C for 3 h on a Labquake rotator (ThermoFisher Scientific). The beads were washed with 1 mL cold lysis/binding buffer four times at 300 g for 4 min at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 µM TMRM (tetramethylrhodamine, methyl ester, perchlorate; Invitrogen), and incubated at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2020Quote: ... methyl ester (TMRM) (0.1µM in hepatocyte medium, Thermo Fisher) to visualize active mitochondria ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Bioengineering 2022Quote: ... mitochondrial membrane potential (tetramethylrhodamine methyl ester, TMRM; ThermoFisher Scientific) and mitochondrial superoxide (MitoSOX Red ...
-
bioRxiv - Genomics 2022Quote: ... Histone H3 Lysine 4 tri-methyl (ThermoFisher PA5-27029), Histone H3 Lysine 27 acetylation (Abcam ab4729) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... 12.5 mM methyl-α-d-mannopyranoside (Thermo Fisher Scientific), 100 U/ml penicillin ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were stained with tetramethylrhodamine methyl ester (TMRM) (Invitrogen) at a non-quenching concentration (20nM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... methylparaben (Methyl 4-hydroxybenzoate, MP; Acros Organics, CAT: 126961000), and butylparaben (Butyl 4-hydroxybenzoate ...
-
bioRxiv - Genetics 2023Quote: ... and Tetramethylrhodamine methyl ester (TMRM, 0.1µM, Thermo Fisher I34361) for 30 minutes at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: ... and tetramethylrhodamine methyl ester perchlorate (TMRE) (ThermoFisher, Waltham, MA) dyes ...
-
bioRxiv - Microbiology 2020Quote: ... 5% CO2 and 5% O2 at 37°C in RPMI 1640 containing AlbuMAXII (Thermo Fisher Scientific) supplemented with 2 mM L-glutamine ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Bioengineering 2021Quote: ... Apoptosis was detected by incubating devices with 5μM of CellEvent™Caspase 3/7 Green detection reagent (Invitrogen) for 30 minutes at 37°C.
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were incubated for 30 min in standard media with CellEvent Caspase 3/7 (1:400, C10423, Invitrogen) prior to imaging to observe apoptosis.
-
bioRxiv - Immunology 2020Quote: ... splenic NP366-374 TMEM were assessed with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay kit (ThermoFisher). Lung single cells were stained with surface markers then incubated with caspase 3/7 green detection reagent for 30 minutes at 37°C as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...