Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and GlutaMAXTM at 37°C with 5% CO2 (Gibco). XP2YO ...
-
A Drug-Free Pathogen Capture and Neutralizing Nasal Spray to Prevent Emerging Respiratory InfectionsbioRxiv - Bioengineering 2023Quote: ... at 37°C and 5% CO2 in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... One portion was incubated for 16 h at 4°C with Dynabeads (Thermo Fisher Scientific) directly conjugated to anti-CD9 antibody with rotation ...
-
bioRxiv - Cancer Biology 2021Quote: ... The concentration of total RNA was estimated using a Nanodrop One C (Thermo Fisher Science) and RNA library formation was performed using the Illumina HiSeq 6000 (Illumina) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The DNA of each sample was quantified in a Nanodrop One C spectrophotometer (Thermo Scientific) and aliquoted at 20 ng/µL in ultra-pure water ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Neuroscience 2023Quote: P29 mice were anesthetized with isoflurane (1–3%) and 50 nl of the retrograde tracer cholera toxin subunit B (5% wt./vol in PBS, ThermoFisher Scientific, Cat # C-34775) were injected at 10nl/sec into the left SLM (ML ...
-
bioRxiv - Immunology 2022Quote: ... and 250nM tetramethyl rhodamine methyl ester (TMRM, ThermoFisher) for 30 minutes at 37°C prior to extracellular staining and flow cytometry ...
-
bioRxiv - Immunology 2024Quote: ... 100 nM tetramethylrhodamine methyl ester (TMRM, ThermoFisher Scientific). 500 nM CellROX or 1 μM MitoSOX in HBSS at 37°C for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 72°C - 3 min) then cloned into Topo PCR 2.1 (Invitrogen) and sequenced ...
-
bioRxiv - Plant Biology 2023Quote: ... for 40 cycles (15 seconds at 95°C, 1 minute at 60°C) in a QuantStudio 6 Flex instrument (ThermoFisher). Percentage of input was calculated as 100* e(CtIN – log2(DF ...
-
bioRxiv - Physiology 2019Quote: Total RNA samples were extracted from one thousand 4-7 day-old Culex female antennae with TRIzol reagent (Invitrogen, Carlsbad, CA). Antennal cDNA was synthesized from 1 µg of antennal total RNA from each species using iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... subsequently buffer exchanged by using 7 K MWCO Zeba Spin Desalting Columns and the concentration was measured by Nanodrop One (Thermofisher Scientific).
-
bioRxiv - Biochemistry 2021Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 23°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Cultures were passaged as aggregates every 5-7 days using a collagenase IV solution (Gibco) to detach hESC colonies ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR was performed with Scientific QuantStudio 5 and 7 Real-Time PCR System (Thermo Fisher) using the DyNAmo Color Flash SYBR Green Mix (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in phosphate-buffered saline (PBS)-/- (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in PBS-/- (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: The 2′ O-methyl phosphorothioate AOs were transfected into dermal fibroblasts as lipoplexes using 3 μl of Lipofectamine 3000 (Life Technologies, Melbourne, Australia) per 1 ml of OptiMEM ...
-
bioRxiv - Immunology 2021Quote: ... 2020) and reactions were carried out using a QuantStudio 6 and 7 Flex Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: One hundred and fifty tergal gland segments (Segment 7) and control segments (Segment 6) of Dalotia males were dissected in EBSS (Earle’s Balanced Salt Solution; ThermoFisher) and transferred to into 150 µl ice-cold Schneider’s Drosophila medium and fetal bovine serum (SDM+FBS ...
-
bioRxiv - Microbiology 2022Quote: ... or in 2 ml liquid MSgg with 7-d-old tomato seedlings in a 6-well plate (Thermo Scientific). Each well contained one seedling ...
-
bioRxiv - Developmental Biology 2022Quote: ... hiPSC at day 6-7 after passaging were treated with a 1:1 mixture of TrypLE Select (Life Technologies) and 0.5 mM EDTA/phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... of 0.5% low-melting agarose (FMC) containing a 6:7 ratio of spinal cord medium (MEM with Glutamax (Gibco) supplemented with 4 mg/ml Albumax (Gibco) ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Quantitative RT– PCR was performed using the QuantStudio-6 and -7 Flex Real-Time PCR Systems (Thermo Fisher Scientific) with SYBR® Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Immunology 2022Quote: ... All samples were prepared in triplicate and run on a QuantStudio 6/7 Flex Real-Time PCR System (ThermoFisher). Primer sequences for designated HHV-6 marker (U31 ...
-
bioRxiv - Cancer Biology 2023Quote: ... normalized to the expression of GAPDH on a QuantStudio 6 and 7 Pro real-time PCR system (Applied Biosystems).
-
bioRxiv - Cell Biology 2023Quote: ... Results were analyzed with the Design and Analysis Software QuantStudio 6/7 Pro systems (Thermo Fisher Scientific, version 2.6). Primers 20-23,36-39 (Supplementary Methods Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Results were analyzed with the Design and Analysis Software QuantStudio 6/7 Pro systems (Thermo Fisher Scientific, version 2.6). Primers 20-59 (Supplementary Methods Table 2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were pelleted one last time at 400 x g for 5 min and resuspended into 5 ml of PBS (GIBCO) supplemented with protease inhibitors (ThermoFischer Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) was used for DNA staining ...
-
bioRxiv - Genomics 2019Quote: ... To one portion 10 µL T4 DNA ligase (5 Weiss U/µL, Thermo Scientific) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... and one wash with 50 μl of 5× Maxima H RT buffer (Thermo Fisher). Finally ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell pellets were then resuspended and plated into one well of a 6 well plate (Fisher Scientific 1483211). Cells were left to sit for 5 days at 37°C and 5% CO2 after initial plating and were only fed once after three days by adding an additional volume of FCM ...
-
bioRxiv - Neuroscience 2023Quote: ... EBs were seeded on one well of a 6-well plate coated with poly-Ornithine/Laminin (Thermo Scientific). Medium was changed every other day ...
-
bioRxiv - Neuroscience 2020Quote: In vivo mitochondrial ROS production in immunostained microglia was measured by injecting dihydro-ethidium (DHE; Invitrogen by Thermo Fisher Scientific, D11347), as it is specifically oxidized by superoxide to red fluorescent ethidium ...
-
bioRxiv - Neuroscience 2020Quote: In vivo mitochondrial ROS production in immunostained microglia was measured by injecting dihydro-ethidium (DHE; Invitrogen by Thermo Fisher Scientific, D11347), as it is specifically oxidized by superoxide to red fluorescent ethidium ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...