Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 7 Benzyl 2 7 Diazaspiro 3.5 nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... coli phosphate-binding protein labeled with 7-Diethylamino-3-[N-(2-maleimidoethyl)carbamoyl]coumarin (MDCC) (phosphate sensor, CAT # PV4406, Thermo Fisher) upon binding of the free phosphate GTP hydrolysis product (excitation at 425 nm ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The redox homeostasis of promastigotes was monitored both qualitatively and quantitively by 2-7 dichlorodihydro fluorescein diacetate (DCFDA) (Life Technologies, USA) staining ...
-
bioRxiv - Neuroscience 2021Quote: ... Percent of cell death was determined by staining with 7 μM Hoechst 33342 and 2 μM propidium iodide (PI) (Invitrogen, USA). PI were diluted in warm neuronal culture medium and incubated for 5 min and then images were taken by a Zeiss microscope equipped with automated computer assisted software (Axiovision 4.6 ...
-
bioRxiv - Cell Biology 2021Quote: ... day 7 and day 19 samples all cells were adherent and collected using 2 ml/well accutase (Thermo Fisher Scientific, A1110501) and a cell scraper ...
-
bioRxiv - Microbiology 2021Quote: ... CAS number: 328–42–7), 2-Ketoglutaric acid, disodium salt, dehydrate (>99%, CAS number: 305–72–6) were purchased from Acros Organics, Belgium ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1x PBS twice and incubated for 20 min in dark at 37°C with 20 µM of H2DCFDA (2’,7’- dichlorodihydrofluorescein diacetate; I36007, Thermo Fisher) diluted in serum-free medium ...
-
bioRxiv - Immunology 2022Quote: ... reactions were heated to 70 °C for 2 min and 15 μl loaded on 15% polyacrylamide gels containing 7 M urea (Invitrogen, EC8852BOX). Low range ssRNA Ladder (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-axis tilts were collected from −60° to +60° at 2° increments at 7 □µm defocus on a Falcon 3 camera (Thermo Fisher) operated in linear mode at 22,000X magnification ...
-
bioRxiv - Cell Biology 2023Quote: Gene expression of targets listed in supplemental table 2 were analysed by SYBR green-based qPCR analysis using Applied Biosystems QuantStudio 7 Real-Time PCR Systems (Thermo Scientific), following the standard PCR cycling sequence using GAPDH as an internal control ...
-
bioRxiv - Microbiology 2023Quote: ... plated at a density of 7 x 106 cells in a 175 cm2 tissue culture flask in 2% FBS (Gibco, MA)/1X non-essential amino acids (Gibco ...
-
bioRxiv - Pathology 2023Quote: ... The mRNAs were quantified using individual TaqMan assays described in Supplemental Table 2 on an ABI QuantStudio 7 Real-Time PCR machine (Applied Biosystems) using TaqMan Fast Advanced Master Mix (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1,000g for 2 min and then immediately loaded into the QuantStudio 6 and 7 Flex real-time PCR system (ThermoFisher Scientific). A two-step cycling protocol was implemented to collect cycle threshold (Ct ...
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were washed and re-suspended in PBS buffer free of KCl and incubated in the dark with 25-μM of 2’,7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) suspended in dimethylsulfoxide (DMSO) for 60 min at room temperature (Molecular Probes, Invitrogen). After incubation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Library concentration was normalized to 2 nM and concentrations validated by qPCR on a ViiA-7 real-time thermocycler (Applied Biosystems), using qPCR primers recommended in Illumina’s qPCR protocol and Illumina’s PhiX control library used as a standard ...
-
bioRxiv - Immunology 2023Quote: ... Serum starved PANC-1 and MiaPaCa-2 cells were incubated with human properdin (20 µg/ml) and CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (5 μM ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... Ten-μg protein of each sample were separated by electrophoresis in 15% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride (PVDF) membranes (Roth) for 7 min at 20V using the iBlot 2 Dry Blotting System (ThermoFisher Scientific), before blocking in TBS-T with 5% (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... fluorescence was observed under a confocal microscope (LSM880NLO, Zeiss, Germany) using 2’,7’-dichlorodihydro fluorescein diacetate (H2DCFDA, 10 InvM, Invitrogen, USA) as described by Yu et al ...
-
bioRxiv - Microbiology 2024Quote: ... 7 μl per injection was loaded onto a 2 mm by 0.3 mm Acclaim PepMap C18 trap column (Thermo Fisher Scientific) in 0.1% TFA at 15 μl/min before the trap being switched to elute at 0.25 μl/min through a 50 cm by 75 μm EASY-Spray C18 column ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then dried at 100°C and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Cell Biology 2024Quote: ... The flow-through was then dried in a speed-vac and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 mM TCEP) with Zeba 7 kDa MWCO spin columns (ThermoFisher), re-quantified by A280 absorbance ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Cell Biology 2021Quote: ... and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific, USA) (52) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Microbiology 2021Quote: ... with 7 ml per plate in the following medium: RPMI-1640 (Gibco), 2 mM L-glutamine (LifeTechnologies) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... Coverslips were carefully transferred to glass slides (Fisher Scientific, #12-544-7) and fixated using AquaPolymount (Polysciences Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunohistochemical staining was performed to confirm the presence of cytokeratin-7 (Thermofisher), pan-vimentin (DAKO) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using ViiA 7 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... EPCR PE (Clone RMEPCR1560, SCT) and 7-Aminoactinomycin D (7AAD) (Life Technologies). The cells were sorted on an Influx (BD ...