Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 6H Imidazo 4 5 e 2 1 3 benzothiadiazole 7 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol] and was resolved by SDS-PAGE on 4% to 12% Bis-Tris gels (Invitrogen). Proteins were transferred to a polyvinylidene difluoride immobilon TM-P membrane (Millipore ...
-
bioRxiv - Immunology 2023Quote: ... we injected the mice intraperitoneally with 4 mg/ml of 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Waltham, MA) with the goal of labeling circulating monocytes to assess macrophage retention among groups ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear staining was performed using 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng ml−1; Molecular Probes). Sections were cover-slipped using ProLong Glass mounting agent (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... E-cadherin (1: 500; Thermo Fisher Scientific, 13-1900), NKX2.1 (1:200 ...
-
bioRxiv - Developmental Biology 2021Quote: ... E-cadherin (1: 1500, Thermo Fisher Scientific, 13-1900), NKX2-1 (1 ...
-
bioRxiv - Neuroscience 2021Quote: ... EGF-Alexa647 (1:300; Molecular Probes, Cat# E-35351), and biotinylated anti-mCD133 (rat monoclonal ...
-
bioRxiv - Developmental Biology 2022Quote: ... E-cadherin (1: 1500, Thermo Fisher Scientific, 13-1900) and CD44 (1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... E-cadherin (1: 1500, Thermo Fisher Scientific, 13-1900), GFP (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-E-Cadherin (1:400, Invitrogen, 13-1900); cell proliferation antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (1:10,000, Invitrogen) for 3 min and eventually coverslips were mounted with Dako mounting kit (Fluka) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mmol/l 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco, Germany #15630056), 2.5 ng/ml human fibroblast growth factor-basic (hFGF2 ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10 000, Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... and 1:4 pD614G-SARS-CoV-2-spike:pPyEGFP using Lipofectamine 2000 (Life Technologies), and media was replaced on day 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1:500 dilution of DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (ThermoFisher). The brain slices were washed 3x with 1XPBS and then mounted with mounting media (Fluoro-Gel ...
-
bioRxiv - Immunology 2020Quote: ... and stained for DAPI (4′,6-diamidino-2-phenylindole) (Life Technologies, 1:1000). For each condition ...
-
bioRxiv - Cell Biology 2021Quote: ... coverslips were stained with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, 1:10,000) in 1X PBS for 5 min.
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% human serum (Valley Biomedical) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 10% human serum (Valley Biomedical ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% human serum (Valley Biomedical) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 10% human serum (Valley Biomedical ...
-
bioRxiv - Cell Biology 2024Quote: ... and stained with 4’,6-diamdino-2-phenylindole (DAPI) (1:500, ThermoFisher, 62248) in 1X DPBS for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... sections were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) and mounted with glycerol-gelatin aqueous slide mounting medium (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then visualised using 1 µg ml-1 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) or 4 µM TO-PRO-3 Iodide (TOPRO ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1:10 every 2–3 days with 1× trypsin-EDTA 0.25% (Gibco 25200-056).
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Microbiology 2019Quote: ... the adherens junction protein E-cadherin was stained using an anti-E-cadherin HECD-1 monoclonal antibody (Invitrogen) at 1:100 with subsequent incubation with the secondary DyLight594 conjugated anti-mouse antibody (1:100) ...
-
bioRxiv - Molecular Biology 2020Quote: ... each of the libraries was diluted 4-fold prior to running on a 1% Agarose E-gel (Life Technologies, #G402001, Carlsbad, CA) with a E-Gel 1-Kb Plus DNA Ladder (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Time lapse imaging (15 minute intervals over 6h) of mCherry or CellTracker Deep Red (Thermo Fisher #C34565) signal was performed utilizing the Thermo Fisher ArrayScan VTI HCS platform ...
-
bioRxiv - Microbiology 2020Quote: ... RBD-6H (340-538; NITN.GPKK) was chemically biotinylated using EZ-link Sulfo-NHS-Biotin (A39256; Life Technologies). Serial half-log dilutions (starting at 1 μM ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were treated +/- rhNODAL (10 ng/mL) for 6h and RNA was harvested using TRIzol™ (Invitrogen). RNA was subjected to expression profiling at the London Regional Genomics Centre essentially as previously described102,103 ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (2◻×◻10-5 M, ThermoFisher), penicillin (100◻IU◻per ml ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM Mg(OAc)2 (Invitrogen), 0.55 mM spermidine (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 7 minutes at 20 V using iBlot 2 (Thermo Fisher Scientific). Blots were blocked in 5% dried milk (AppliChem ...
-
bioRxiv - Neuroscience 2021Quote: ... or 10 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific #D399), an MRP family substrate ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N and D35C4-20-1.5N) ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N) ...
-
bioRxiv - Molecular Biology 2023Quote: ... by the iBlot 2 transfer system (Invitrogen, 20 V for 7 min). The membranes were blocked with 3% nonfat milk or ECL PrimeTM blocking agent (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Genetics 2019Quote: ... Samples were then pooled together and run on a 4% agarse E-Gel (Life Technologies), and the 140-160 nt length bands were excised and purified using MiniElute Gel Extraction Kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... The amplified sequences were purified on E-Gel® EX 4% Agarose gels (ThermoFisher # G401004), and sequences representing RNA smaller than 200 nt were extracted from the gel ...
-
bioRxiv - Genetics 2023Quote: ... the samples were pooled and electrophoresed on a 4% agarose E-Gel from Life Technologies. Bands ranging in length from 140 to 160 nt were carefully excised and purified using the MiniElute Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Cancer Biology 2023Quote: H&E staining for mouse tissues were fixed in 10% formalin (SF98-4, Thermo Fisher) processed in UF pathology core ...