Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 6H Imidazo 4 5 e 2 1 3 benzothiadiazole 7 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Gel purification of pooled products from a 2% E-gel EX (Life Technologies) were performed using the QiaQuick Gel Extraction kit (Qiagen).
-
bioRxiv - Developmental Biology 2020Quote: ... Quality of amplified product was checked with a 2% E-Gel (ThermoFisher Scientific) before Illumina sequencing adapters were added in a subsequent PCR reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by size-selection and extraction from a 2% E-gel EX (Invitrogen). Single-end 84 nt sequence reads were generated using the NextSeq 500 system (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were size-selected with E-Gel EX 2% agarose gels (Life Technologies) and purified by QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Neuroscience 2024Quote: ... The amplified DNA was resolved on E-Gel 2% agarose gel (Invitrogen, G401002) on E-Gel Power Snap Electrophoresis device (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... and products separated on 2% EX e-gels containing SYBR Gold II (Invitrogen). qRT-PCR using custom TaqMan primers/probes was performed with TaqMan Fast Advanced Master Mix on a QuantStudio 3 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Physiology 2022Quote: ... then perfused the lungs with 3 mL of ice-cold DPBS containing Ca2+ and Mg2+ followed by 5 mL of 4% methanol-free formaldehyde (ThermoFisher) in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1% penicillin/streptomycin with passaging every 3–4 days using in DPBS (Life technologies) supplemented with 0.5 mM EDTA (Life technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... 1:100 human IgG (1 mg/ml) as FcR block and 2 % FCS using the following staining reagents: 7-AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated with mouse mAb SARS-CoV-2 nucleocapsid antibody (SinoBiological, 1:100) and rabbit Claudin 7 polyclonal antibody (ThermoFisher, 1:200) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The iPSCs were then cultured for 7 days in Neurobasal/DMEM-F12 medium (1:1 v/v) containing 2% B27 (Gibco, 17054–044), 1% N2 (Gibco ...
-
bioRxiv - Molecular Biology 2022Quote: ... 484 bp for group 2) was excised using a 2% E-Gel SizeSelect Agarose Gels (Thermo Fisher Scientific). The sequence library was adjusted to 10 pM (assuming 1 bp DNA has a molecular weight of 660 g/mol ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies] ...
-
bioRxiv - Neuroscience 2022Quote: ... the percentage of apoptotic astrocytes was evaluated using CellEvent Caspase-3/7 Green Detection Reagent (1:250; Thermo Fisher, cat. #C10423) added directly to the medium ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were changed to a fresh medium containing phenol-red-free Williams E supplemented with 5 % CCS and 1 mM glutamine (Invitrogen, CA) and incubated for 22 to 24 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... washed twice in DMEM with 10% CCS and suspended in Williams E medium supplemented with 5 % CCS and 1 mM glutamine (Invitrogen, CA). To separate live from dead cells ...
-
bioRxiv - Biochemistry 2019Quote: ... 7-hydroxy-4-cyanocoumarin (CHC) and BODIPY 577/618 maleimide were from Invitrogen/Molecular Probes Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and CellTracker Blue CMAC (7-amino-4-chloromethylcoumarin) dye (Life Technologies, Carlsbad, CA) as a vacuole lumen marker ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... methyl ester (TMRM) (Cat# I34361, Invitrogen) and 1ug/ml Hoechst 33342 (Cat# H3570 ...
-
bioRxiv - Immunology 2021Quote: ... methyl ester (TMRM; Invitrogen cat #T668) in serum-free RPMI media for 45 minutes at 37°C per manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... Tetramethylrhodamine methyl ester perchlorate (TMRM, Invitrogen) was used to stain cells at concentrations of 50 or 10 nM ...
-
bioRxiv - Microbiology 2023Quote: ... MES and methyl-salicylate (ACROS Organics); sodium ferulate (Selleck Chemical) ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl ester (TMRM, Thermo Fisher Scientific). Cells were loaded with 20 nM TMRM for 30 minutes at 37°C and then transferred to the imaging system ...
-
bioRxiv - Bioengineering 2022Quote: Cell apoptosis was evaluated with CellEvent® Caspase 3/7 Green (Thermo Fisher, UK), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... CellEvent Caspase-3/7 green flow cytometry assay kit was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with CellEvent caspase-3/7 green detection reagent (ThermoFisher cat # C10423) according to manufacturer’s instructions at a final concentration of 8 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Cell Biology 2023Quote: ... flow cytometric apoptosis quantification was performed using the CellEvent Caspase 3/7 kit (ThermoFisher) following the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).
-
bioRxiv - Bioengineering 2020Quote: ... 5 μm-thick serial sections were stained with hematoxylin and eosin (H&E; ThermoFisher) or Von Kossa (VK ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 μm-thick serial sections were stained with hematoxylin and eosin (H&E; ThermoFisher) or Von Kossa (VK ...