Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Media was changed every second to third day and mucus clearance was performed every 4-5 days with 5 minutes apical PBS (ThermoFisher) incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... were incubated for 4 h in DMEM/F12 containing 5% horse serum (Gibco) and 5% foetal bovine serum (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA (5 μg) was separated in 4-20% TBE gel (ThermoFisher scientific), described above.
-
bioRxiv - Microbiology 2021Quote: ... 14.5 μl of preheated reaction mixture [4 μl First Strand buffer (5 ×, Invitrogen), 1 μl 0.1 M dithiothreitol ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in groups of 5/well using 4-well plates (ThermoFisher). Individual HIO lumens were microinjected using a glass caliber needle with 1μl of PBS control or different STm mutants (105CFU/HIO or 103CFU/HIO for 24h infections) ...
-
bioRxiv - Pathology 2021Quote: ... washed platelets were stained with Fluo-4 AM (5 μM, Thermo Fisher Scientific) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... which included 5 µL 4× Taqman Fast Advanced Master Mix (Thermo Fisher Scientific), 0.4 µL of each primer (tat 2.0 and rev ...
-
bioRxiv - Genomics 2023Quote: ... hiPSC-CMs were loaded with Fluo-4-acetoxymethyl (AM)-ester (5 μM, Invitrogen) in Tyrode’s buffer (135 mM NaCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (ThermoFisher Scientific, 90115) for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were loaded with 5 μM of Fluo-4-AM (Thermo Fisher Scientific) for 50 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% CO2 for 4 minutes and resuspended in E8 medium (Thermo Fisher Scientific) and 10 μM Y-27632 Rho-kinase inhibitor (ROCKi ...
-
bioRxiv - Bioengineering 2023Quote: ... calcium imaging was performed using 5 μM Fluo-4-AM (ThermoFisher, F14201, US) in Krebs-Ringer’s solution containing NaCl 119 mM ...
-
bioRxiv - Neuroscience 2024Quote: Protein (5 µg) was loaded on NuPAGE 4–12% Bis-Tris gels (ThermoFisher), separated by electrophoresis and transferred to Hybond PVDF membrane (GE Healthcare) ...
-
bioRxiv - Physiology 2024Quote: ... cells were loaded with 5 µM of Fluo-4-AM (Thermo Fisher Scientific) or for 50 min at room temperature in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4-5 mg/mL of Ellman’s reagent (Thermo Fisher Scientific, Waltham, MA) were dissolved in a sodium phosphate buffer (0.1M NaH2PO4 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were split every 4-5 days with TrypLE Select Enzyme (Life Technologies) as previously described ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were centrifuged at 14,000g for 5 minutes at 4°C and electrophoresed on NuPAGE™ 4-12% Bis-Tris Polyacrylamide gels (Thermo Fisher) with NuPAGE™ MOPS running buffer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... (4) 30 min incubation in ammonium chloride (NH4Cl) and (5) 4 min incubation in Tissue Autofluorescence Quenching Kit (ReadyProbes, ThermoFisher Scientific).Secondary antibodies were used as follows ...
-
bioRxiv - Bioengineering 2024Quote: ... The next day the membrane was washed three times with 5% milk and incubated for 4 hours at 4°C in an anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) assay (cat no. V13154; Thermo Fisher) for determining cell viability after different tunicamycin treatments as per the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2022Quote: ... cells were rinsed in DPBS and incubated with 2 μg/ml DAPI (4′,6-diamidino-2-phenylindole, 62248; ThermoFisher) and 1:500 Alexa Fluor Plus 647 conjugated goat anti-rabbit secondary antibodies (A32733 ...
-
bioRxiv - Systems Biology 2023Quote: ... A 1 mL aliquot of 2:2:1 (v/v) mixture of ≥ 99.9% purity acetonitrile (Fisher Scientific; Cat.A998-4) ≥ 99.8% purity methanol (Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4′-6-diamidino-2-phenylindol) and Myosin Heavy Chain (Myosin 4, eFluor™ 660, Clone: MF20, Affymetrix eBioscience™). All images were taken using a confocal microscope (Zeiss LSM 780 Airyscan ...
-
bioRxiv - Biochemistry 2022Quote: ... The complex was eluted by rotating the tubes for 2 hours at 4 °C in elution buffer containing 4 mM SDA (NHS-diazirine, succinimidyl 4,4′-azipentanoate, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 4% 2-Mercaptoethanol and Bromophenol Blue) and loaded on NuPAGE 4-12% Bis-Tris Gel (catalog #WG1402BOX; Thermo Fisher Scientific). Proteins were transferred on PVDF membrane (catalog #162-0177 ...
-
bioRxiv - Microbiology 2023Quote: Epimastigotes and trypomastigotes lysates containing 2 x 107 parasites in 20 µL of SDS-PAGE sample buffer containing 5 mM DTT were boiled for 5 min and loaded onto precast Novex Value 4-12% Tris-Glycine gels (Thermo Fisher). The electrophoresis was performed in 50 mM MOPS-50 mM Tris Base ...
-
bioRxiv - Microbiology 2024Quote: ... then fixed in 4% PFA and stained with 5 μg/ml DAPI and 5 μg/ml CellMask Deep Red (Invitrogen C10046). Plates were imaged using the Opera Phenix high-content screening system ...
-
bioRxiv - Neuroscience 2021Quote: ... Fly brains were incubated with 100 nM Tetramethylrhodamine methyl ester (TMRM) (Invitrogen, I34361) for 30 min at 37 °C and washed three times with Hank’s balanced salt solution (HBSS) ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were loaded with 10 nM Tetramethyl Rhodamine Methyl Ester (TMRM) (Molecular Probes) and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... and the mitochondria-specific dye tetramethylrhodamine methyl ester (TMRM, 25nM; Thermo Fisher Scientific) diluted in Hanks solution (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... FM4-64 and leucyl-L-leucine methyl ester (LLOMe) were from Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... and subsequently alkylated with 50 mM S-methyl methanethiosulfonate (MMTS) (Thermo Fisher Scientific) in USS for 1 h at room temperature ...
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... N-methyl-D-aspartate receptor 1 (NMDAR1, rabbit, 1:1000, Invitrogen PA5-34599), N-methyl-D-aspartate receptor 2B (NMDAR2B ...
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... Cells were incubated with 15 nM tetramethyl rhodamine methyl ester (TMRM; #T668; Invitrogen) in culture medium for 25 min at 37°C and 5% CO2 in the dark ...
-
bioRxiv - Cell Biology 2024Quote: ... MitoTracker Red CMXRos and TMRM (Tetramethylrhodamine, methyl ester) (Molecular Probes, Invitrogen, Paisley, UK) were used to assess mitochondrial membrane potential (ΔΨm) ...
-
bioRxiv - Cell Biology 2024Quote: ... MitoTracker Red CMXRos and TMRM (Tetramethylrhodamine, methyl ester) (Molecular Probes, Invitrogen, Paisley, UK) were used to assess mitochondrial membrane potential (ΔΨm) ...
-
bioRxiv - Cell Biology 2024Quote: Mitochondrial membrane potential was visualized with tetramethylrhodamine methyl ester (TMRM; Thermo Fisher Scientific) as described previously (Steinberg et al. ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
bioRxiv - Pathology 2024Quote: ... according to manufacturer specifications in the presence of 10mM 5-Bromo-2’-Deoxyuridine 5’-Triphosphate (BrdUTP, Thermo Scientific, B21550), at 37°C in a dark humidified slide box for 90 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... resuspended in 2% FBS in HBSS containing 5 g/ml DAPI (Invitrogen), and sorted into DMEM containing 10% FBS ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl 5 M NaCl and 1 µl GlycoBlue co-precipitant (Invitrogen). Samples were vortexed and incubated at room temperature for 15 min ...