Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... overnight and then loaded with Fluo-4 (1:1000; Fluo-4 Calcium Imaging Kit; Invitrogen) and CellTracker Red (1:2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with one of the following secondary antibodies: 1) donkey anti-mouse 488 (1:250; Invitrogen, USA); 2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Immunology 2021Quote: ... Samples from Biosafety Level 3 were inactivated for 2 hours at RT with 4% paraformaldehyde (ThermoFisher Scientific) after extracellular and intracellular staining.
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged after reaching 70-85% confluency (every 3-4 days) using Accutase (Gibco #A11105-01) to disperse into single cells and replated in mTeSR1 supplemented with 1% P/S containing 10 µM Rock Inhibitor (Y-27632 ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described.13 Cells were passaged every 3-4 days using Collagenase Type IV (Life Technologies). Expression of pluripotency markers was analyzed by flow cytometry using SOX2 (Cell Signaling ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 hours for E14.5 and 4 hours for E18.5 tissues and then blocked in CAS Block (ThermoFisher) for at least two hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were subcultured every 3-4 days by washing with Dulbecco’s phosphate buffered saline (DPBS, GibcoTM, ThermoFisher) and detached with trypsin (GibcoTM ...
-
bioRxiv - Immunology 2022Quote: ... Epithelium was then collected by centrifugation (3 min, 300g, 4 ºC) and digested by TrypLE express (Gibco) for 1 minute at 37ºC and vortexed ...
-
bioRxiv - Microbiology 2022Quote: ... adding 3 mL HPLC grade methanol and 2 mL HPLC grade chloroform (C297-4, Thermo Fisher Scientific), then shaking at 22°C for 1 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated by NuPAGE 3-8% or 4-12 % Tris-Acetate Midi Gel (Invitrogen, Cat# WG1402BX10) and transferred to nitrocellulose membranes (Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Genomics 2023Quote: ... and CRISPRmap library plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000001) in lentiviral packaging medium (Opti-MEM (Thermo Fisher Scientific 31-985-070 ...
-
bioRxiv - Microbiology 2023Quote: ... N-(3-triethylammoniumpropyl)-4-(p-diethylaminophenyl-hexatrienyl) pyridinium dibromide (FM4-64) (Thermo Fisher Scientific, Waltham, MA, USA) as previously described (9) ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were passaged at 70-80% confluency every 3-4 days into Geltrex coated dishes (Life Technologies) using gentle cell dissociation reagent (STEMCELL-Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt (DiD, catalog number: D7757) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2023Quote: ... for 3-4 days to OD 0.6 in tryptone soya broth (Oxoid) supplemented with 10% FCS (Gibco) and the antibiotics above ...
-
bioRxiv - Cell Biology 2024Quote: ... ells were stained with 3 mM Fluo-4-AM for 25 minutes in DMEM (Thermo Fisher, 10567014). After two washes with DPBS ...
-
bioRxiv - Biophysics 2024Quote: The annealed RNA structure (4 fmol) was mixed with 3 µl of MyOne T1 streptavidin beads (Invitrogen) in Hybridization Buffer (10% PEG8000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the whole medium was changed containing two parts E8 medium and one part neural differentiation medium (NDM) containing 1:1 DMEM F12 / Neurobasal medium supplemented with 1% B27 (Thermo Fisher, 12587010) 0.5% N2 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 ml was diluted 1:1 with PBS (Thermo Fisher Scientific, Waltham, MA) and kept on ice for purity analysis by flow cytometry ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 µM ethidium homodimer-1 and 1 µg ml-1 Hoechst 33342 (Thermofisher, 62249) was added to chondrocyte-laden alginate hydrogels and was incubated for one hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Sample concentration and purity was determined with the NanoDrop One (ThermoFisher, Cat # ND-ONE-W).
-
bioRxiv - Cell Biology 2024Quote: ... The labeling efficiency was calculated using NanoDrop One Spectrophotometer (Thermo Fisher Scientific #ND-ONE-W). The average probe labeling efficiency was ∼90% ...
-
bioRxiv - Plant Biology 2024Quote: ... The powdered plant leaves were dissolved in 300 μl of 1 x non-reducing SDS buffer with or without 8 mM methyl-PEG-maleimide reagent (Thermo Scientific, Cat. No. 22713). After incubation at 25 °C for 1 h in the dark with shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by secondary staining for one hour at RT (1:250, Alexa-488, Invitrogen, A11008). Images were taken using a LSM 510 confocal microscope (Carl Zeiss ...
-
bioRxiv - Biochemistry 2020Quote: ... One aliquot was treated with DSG (disuccinimidyl glutarate) crosslinker (1 mM) (Thermo Scientific, Cat# 20593) and the other served as a DMSO only negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... 60 degrees for 1 min] x 40 cycles) on a Step-One Plus (Applied Biosystems) using Sybr Green (Bio-rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one guide sequence (Table 1) was generated by following the MEGAscript®Kit (Invitrogen) protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were stained for one hour with phalloidin Alexa fluor 488 (1:300, ThermoFisher, A12379) or phalloidin Alexa fluor 568 (1:300 ...
-
bioRxiv - Genomics 2024Quote: ... one third of the vegetative stage cells were resuspended in 1 ml TRIzol Reagent (Invitrogen) and stored at −20°C until further processing ...
-
bioRxiv - Microbiology 2023Quote: ... RNA quality was verified by 1% agarose electrophoresis and quantified using Nanodrop One (Thermo Scientific). As control ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked on 1% agarose gel and concentration measured with a NanoDrop One spectrophotometer (ThermoFisher). Double-stranded RNA targeting the gene encoding the green fluorescent protein (dsGFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Third instar larvae were dissected with cold HL3 and immediately fixed with PFA (4%) and incubated overnight at 4 C with primary antibodies (rabbit anti-Dlg, 1:1000; anti-Brp 1:100, Life Technologies). Alexa-conjugated secondary antibodies were used for secondary staining (Jackson Laboratories 1:500) ...
-
bioRxiv - Immunology 2020Quote: PBMC (1-2*10^6 cells) and pDC (1-4*10^4) were maintained for 16 h in RPMI1640+10% FBS+ 1% (PS) (Gibco Laboratories) in 96 well round bottom plates ...
-
bioRxiv - Immunology 2023Quote: ... Drosophila S2 cells were mixed with Ramos cells or B1-8hi B cells at a ratio of 1:4 (4×105 B cells and 1×105 S2 cells) followed by total RNA extraction with TRIzol reagent (Thermo Fisher), DNaseI digestion ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Genetics 2021Quote: ... containing a 4:1:1 mixture of Lipofectin transfection reagent (ThermoFisher Scientific), water and BAC DNA (~ 15 μg DNA per larva) ...
-
bioRxiv - Cell Biology 2024Quote: ... a premium microscope slide (Fisher-finest, 3″ × 1″ × 1 mm; Thermo Fisher Scientific, 12-544-1) or chambered coverglass (1 well ...
-
bioRxiv - Plant Biology 2021Quote: ... these were extracted and dialyzed against 25 mM Tris pH 7.5 at 4 °C and measured using a Nanodrop One (Thermo Fisher Scientific, Waltham, MA). Particles for cryo-EM were dialyzed against 20 mM NaOAc ...
-
bioRxiv - Systems Biology 2020Quote: ... and 4 μL of this dilution were used to transform One ShotTM ccd B Survival 2 T1R competent cells (Thermo Fisher Scientific, A10460). Transformants were selected with 33 μg/mL chloramphenicol (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were incubated at 4°C for one day in PBT with 0.002% Streptavidin conjugated to Alexa Fluor 633 (ThermoFisher Scientific, Waltham, MA, USA), then washed two times in PBT and two times in PB ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were then washed twice with Blocking One (Nacalai Tesque, 03953-95) and incubated overnight at 4 °C with primary antibodies diluted in 10% goat serum (Thermo Fisher Scientific, 16210064)/Blocking One ...