Labshake search
Citations for Thermo Fisher :
7151 - 7200 of 10000+ citations for Biotin Z Antibody Internalization Kit rabbit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Biotinylated proteins were eluted in elution buffer (20 µL of 20 mM DTT and 2 mM Biotin in 1X NuPAGE LDS lysis buffer (ThermoFisher) with protease inhibitor and phosphatase inhibitor ...
-
bioRxiv - Neuroscience 2022Quote: ... human BDNF-biotin (Alomone labs; B-250-B) was conjugated to Quantum dots-605 (QD-605) (Thermo Fisher Scientific; Q10103MP). Primary antibodies for immunofluorescence included rabbit anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Plant Biology 2023Quote: ... Transfer to a nylon membrane and detection of biotin-labeled DNA were performed according to the manufacturer’s instructions (Thermo Scientific 20148 LightShift Chemiluminescent EMSA Kit).
-
bioRxiv - Neuroscience 2024Quote: ... The following day cells were cooled to 4 °C and treated with 0.5 mg/mL EZ-Link Sulfo-biotin-SS-NHS (Thermo Scientific) dissolved in 1XDPBS for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT) and then cDNA was enriched using DynabeadsTM MyOneTM streptavidin T1 magnetic beads (Invitrogen). The beads were washed in 2X binding buffer (10mM Tric-HCL ph7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5-PCBioCTACACGACGCTCTTCCGATCT) and then cDNA was enriched using DynabeadsTM MyOneTM streptavidin T1 magnetic beads (Invitrogen). The beads were washed in 2X binding buffer (10mM Tric-HCL ph7.5 ...
-
bioRxiv - Immunology 2024Quote: ... 21330) and the resulting biotin-labeled protein was purified through a Zeba quick spin column (Thermo Scientific cat no. 89882). The RBD-biotin was prebound with streptavidin-AlexaFluor-647 to make RBD-647 (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... C2C12 cells transfected with EGFP-HRas WT/C181S/C184S in 35mm dishes were treated with 15d-PGJ2-Biotin (5 µM) in DMEM Hi Glucose medium (Gibco) supplemented with 1% Penicillin-streptomycin-Glutamine (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 x 106 BMDCs were stained for 30 minutes on ice with 14.4.4 scFV-AF647-biotin and 14.4.4 scFV-AF555-biotin premixed at a 1:1 ratio and subsequently washed with imaging buffer (1x HBSS (Life technologies) supplemented with 1% FCS (Biowest) ...
-
bioRxiv - Neuroscience 2023Quote: Small molecule leakage into the brain was assessed by EZ-Link Sulfo-NHS-Biotin (MW = 443 kDa, Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... The biotin-PEG layer was functionalized by incubating 15 min with a 0.2 mg/mL solution of neutravidin (Thermo Scientific). Channels were washed with 1mL of HB to remove excess neutravidin ...
-
bioRxiv - Cell Biology 2022Quote: Protein extraction from cell surface fraction was performed with EZ-Link™ Sulfo-NHS-LC-LC-Biotin (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... underlined amino acids are recognized by the T-cell) conjugated with EZ-Link™ Maleimide-PEG2-Biotin (Thermo Fisher Scientific) according to the manufactureŕs instructions.
-
bioRxiv - Pathology 2023Quote: Vip3Aa toxin was biotinylated with a 1:30 (protein:biotin) molar ratio of EZ-Link Sulfo- NHS-LC-Biotin (Life Technologies) for 30 minutes on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... Viably frozen primary AML cells were thawed and CD3-depleted with biotinylated anti-human CD3 (SK7) and biotin-binder Dynabeads (Invitrogen) and subsequently injected via the lateral tail vein into 2.8 Gy irradiated (24h before transplant ...
-
bioRxiv - Microbiology 2023Quote: ... were biotinylated by mixing 50 μM of protein with 50 μM of EZ-Link™ Sulfo-NHS-Biotin (Thermofisher Scientific) followed by incubation on ice for 2 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated for 4 hours at 23°C with the Klenow DNA polymerase I to fill in the 5’ overhang and incorporate biotin-14-dATP followed by chromatin ligation for 4 hours at 16°C with T4 DNA ligase (Invitrogen). Then cells were left overnight in 400 ng/ml proteinase K and 0.5% SDS at 60°C overnight to reverse cross-linking ...
-
bioRxiv - Biochemistry 2023Quote: Porcine brain tubulin was isolated using the high-molarity PIPES procedure as described (Castoldi and Popov, 2003) and then labeled with biotin- or Dylight-405 NHS-ester (Invitrogen) as described (http://mitchison.hms.harvard.edu/files/mitchisonlab/files/labeling_tubul in_and_quantifying_labeling_stoichiometry.pdf) ...
-
bioRxiv - Bioengineering 2023Quote: ... The unreacted dyes were removed using 0.5 mL Zeba™ Dye and Biotin Removal Spin Columns (ThermoFisher Scientific, Waltham, MA). The concentration of the labeled AAV2 and AAV9 in solution was determined by AAV ELISA assay and the concentration of the labeled proteins in solution was determined by Bradford assay ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell surface proteins were then biotinylated by incubation with 1 mg/ml of the cell membrane-impermeable reagent EZ-Link Sulfo-NHS-SS-Biotin (ThermoFisher) dissolved in PBS for 30 minutes at 4 °C with gentle agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... Intact cells were rinsed gently twice with ice-cold DPBS and incubated with the membrane-impermeable biotinylation reagent Sulfo-NHS SS-Biotin (0.5 mg/mL; ThermoFisher Pierce) in DPBS containing 1 mM CaCl2 and 0.5 mM MgCl2 (DPBS-CM ...
-
bioRxiv - Microbiology 2023Quote: ... Airdried membranes were then UV cross-linked (254 nm; 120mJ/cm2) and hybridized to biotin-conjugated probes using the NorthernMax-Gly system following manufacturer protocols (Invitrogen). The following 5’-biotinylated probes were synthesized commercially (IDT) ...
-
bioRxiv - Immunology 2023Quote: ... washed twice and then resuspended in HBSS with αCD3 and αCD28-biotin conjugates (eBioscience) and a live/dead stain (Invitrogen). For flow cytometry analysis ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µM of β2-microglobulin were incubated with 1x molar concentration of EZ-Link Sulfo-NHS-LC-Biotin (Thermofisher 21335) for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... pH 8.2 (PBS+) supplemented with 0.5 mg/mL EZLink Sulfo-NHS-SS-Biotin (30 min on ice; Thermo Fisher Scientific). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... Biotin-labeled DNA fragments was enriched by incubation with 100µl Dynabeads MyOne Streptavidin C1 beads (Thermal Fisher Scientific, Cat#65002) at room temperature for 15min ...
-
bioRxiv - Biochemistry 2023Quote: ... Hisα1-subCD3-WT (Legrand et al., 2020) was biotinylated with EZ-Link™ NHS-PEG4-Biotin (Thermo Scientific™ A39259) in a 1:1.5 ratio at 25°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... the surfaces were rinsed thrice with PBS and the chambers were incubated with 0.5 g/l BSA-Biotin (ThermoFisher, 29130) in PBS overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... γ-TuRC was biotinylated prior to elution by incubation for 1 hour on ice in CSF-xB 2% (w/w) sucrose supplemented with 40 μM NHS-PEG4-biotin (ThermoFisher). The elution was concentrated using a 100 kDa MWCO spin concentrator (Amicon) ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were resuspended at a concentration of 25 × 106 cells/mL in PBS containing 2 mM sulfo-NHS-biotin (Invitrogen). The reaction mixture was then incubated at RT for 60 min ...
-
bioRxiv - Immunology 2024Quote: Affinity purified SARS-CoV-2 (Wuhan) RBD was biotinylated using EZ-Link Sulfo-NHS-LC-biotin (Life Technologies, USA, A39257) accordingly to manufacturing protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... 25 μl/ml BioLock biotin blocker (IBA, 2-0205-050) and 5 μl Pierce Universal Nuclease (Thermo Fisher Scientific, 88702), and kept on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... Biotin-dUTP incorporated into the DNA replication sites were visualized by Alexa Fluor 488-conjugated streptavidin (Thermo Fisher Scientific, #S32354).
-
bioRxiv - Plant Biology 2024Quote: ... 500 ng of total genomic DNA were labelled by random priming with biotin-14-dCTP (Invitrogen by Thermo Fisher Scientific) used as probes.
-
bioRxiv - Plant Biology 2024Quote: ... 500 ng of total genomic DNA were labelled by random priming with biotin-14-dCTP (Invitrogen by Thermo Fisher Scientific) used as probes.
-
bioRxiv - Bioengineering 2024Quote: ... 200 μl of antibody or scFv at 1 mg/ml in PBS was mixed with 10% volume of 1M sodium bicarbonate to adjust pH to 7-8 followed by addition of EZ-Link sulfo-NHS-LC-Biotin (ThermoFisher) to reach a 5:1 biotin:protein molar ratio ...
-
bioRxiv - Biochemistry 2024Quote: ... Preps for use in microtubule nucleation assays were biotinylated by incubation with 40 µM EZ-Link NHS-PEG4-Biotin for 1 hour (ThermoFisher). γ-TuNA/γ-TuRC was eluted by protease cleavage of the HRV3C site with PreScission overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... GFP (Appendix B (Scholz et al., 2000)) was biotinylated using EZ-Link™ NHS-PEG4-Biotin (ThermoFisher, cat. no. A39259) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... or RSV antigen mix were biotinylated with EZ-Link Sulfo-NHS-LC-Biotin following manufacturer’s instructions and coupled to FluoSpheres NeutrAvidin beads (Molecular Probes) (16 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... the membranes were incubated with an appropriate HRP-conjugated secondary antibody (IgG Fc Goat anti-Rabbit, HRP, Invitrogen 31463; IgG Fc Rabbit anti-Mouse, HRP, Invitrogen 31455; IgG Fc Rabbit anti-Goat, HRP, Invitrogen 31433), and diluted in TBST with 3% nonfat dry milk for 1 h at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... the samples were incubated with the appropriate secondary antibody (polyclonal goat anti-mouse IgG1, 1:500, ThermoFisher A21124; polyclonal goat anti-rabbit IgG H&L, 1:500, ThermoFisher A11011, Waltham, USA) diluted in blocking solution for 45 min at room temperature ...
-
bioRxiv - Systems Biology 2020Quote: ... fixed and blocked HeLa CCL-2 cells were incubated with 5 μg/mL Cy5 labeled rabbit anti-Ki67 primary antibodies (Thermo Fisher Scientific; RB1510P1ABX) in the 1X blocking buffer for 45 min at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were washed twice with the PBSA buffer and incubated with the Alexa Fluor® 488 Donkey Anti-rabbit IgG (H+L) Antibody (Thermo Fisher Scientific) at 1:500 dilution for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... and TAP-tagged proteins (TAP-Csm4, TAP-Mps2, and TAP-Mps3) were detected by an anti-TAP rabbit antibody (1:10,000, Thermo Fisher Scientific, cat#CAB1001). The level of Pgk1 was detected by a Pgk1 antibody (1:10,000 ...
-
bioRxiv - Genetics 2021Quote: ... Alexa Fluor conjugated secondary antibodies (Donkey Anti-Goat Alexa Fluor 488, A-11055, Thermo Fisher Scientific; Donkey Anti-Rabbit Alexa Fluor 594, A21207, Thermo Fisher Scientific) were added for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Then coverslips were inverted onto 100 µL of antibody block with secondary antibodies (Alexa Fluor 488 anti-mouse - 1:200, Life Technologies #A11029; Alexa Fluor 594 anti-rabbit – 1:200, Life Technologies A11037) and DAPI (DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies (Supplemental Table 1) were followed by secondary goat anti-mouse or goat anti-rabbit antibody (A11004 or A11008; 1:400; Invitrogen, Thousand Oaks, CA) treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then incubated for 1 h with a secondary antibody (goat anti-rabbit IgG, Alexa Flour 488 conjugate, ThermoFisher Scientific/Invitrogen, R37116) and DRAQ5 (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... Staining was performed with a probe to detect PLP1 expression(Cat no. 564571-C2) and GFAP antibody (rabbit polyclonal, 1:1000, Invitrogen Cat no.10019). Secondary antibody conjugated to flurophores anti-rabbit Alexa Fluor 488 and 647 ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked and incubated with secondary antibodies (Alexa-488 anti-mouse, #A28175, Thermo Fisher Scientific and Alexa-568 anti-rabbit, #A-11011, Thermo Fisher Scientific) for 1 hour at RT ...