Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for GCLC Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant proteins were expressed using the Expi293 Expression system (ThermoFisher Scientific) and purified with HisTrap FF columns (for polyhistidine-tagged spike proteins ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 ng/mL Human TGF-β 1 recombinant protein (Cat# PHG9204, Gibco) and 1 μg/mL L-Ascorbic acid 2-phosphate (Cat# A8960 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant containing recombinant antibody was incubated with protein A resin (ThermoFisher) overnight at 4 °C ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant CtNAT10 protein was expressed in both Sf9 cells (ThermoFisher, cat #12659017) and homemade bGroESL cells (See Experimental Model and Subject Details) ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 % FBS and 200 ng/mL Human M-CSF Recombinant Protein (ThermoFisher). Six days after the initial isolation ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Escherichia coli BL21(DE3) pLysS (Invitrogen) transformed with respective plasmids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human recombinant plasminogen activator inhibitor 1 (PAI-1) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA). The incubator condition was set at 37 °C with 5 % carbon dioxide environment ...
-
bioRxiv - Cell Biology 2023Quote: ... human recombinant fibroblast growth factor 2 (FGF2, 20 ng/mL, Life Technologies), and beta-mercaptoethanol (0.1% ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Recombinant protein was extracted using BugBuster Protein Extraction Reagent (Thermo Scientific, USA) and purified using cOmplete His-Tag Purification Resin (Roche ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human IFN-β (1000 U/ml to 1 U/ml, ThermoFisher) was used as positive controls for IRF activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... human recombinant EGF (10 ng/ml) (Thermo Fisher Scientific, Waltham, MA, USA), D-glucose (5.5 mM ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... bovine pituitary extract and human recombinant epidermal growth factor (Gibco, 37000-015)) and primary gingival keratinocyte (Dermal cell basal medium (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... hiPSCs were cultured on human recombinant vitronectin in StemFlexTM media (Life Technologies) and differentiation was initiated by plating singularised hiPSCs on human embryonic stem cells (hESC)-qualified Matrigel (Corning ...
-
bioRxiv - Biochemistry 2024Quote: ... supernatants or serial dilutions of mouse IL2 recombinant protein (Peprotech, ThermoFisher Scientific) (100 μL/well ...
-
bioRxiv - Cancer Biology 2024Quote: ... 9.7 ng/mL human EGF recombinant protein (Thermo Fisher Scientific, cat. PHG0313), 23.4 µg/mL adenine (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng/mL recombinant RSPO1 (Thermo Fisher Scientific, cat# 120-38-500UG), and 100 ng/ml recombinant noggin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5μL of 40U/μL of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, #10777-019), and 0.5μL 200 U/μL SuperScript III reverse transcriptase ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-IFN-γ neutralizing mAb and/or an isotype IgG1 (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) were intraperitoneally injected daily to mice from PND5 to PND10 ...
-
bioRxiv - Microbiology 2022Quote: ... The V5 epitope was detected with mouse mAb anti-V5 (diluted 1:1000) (Invitrogen, catalong no. R96025). Toxoplasma-specific antibodies include mouse mAb m-IMC1 (diluted 1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-Utr2 mAbs or a commercially sourced anti-Candida mouse IgG2a monoclonal antibody (MA1-7009) (Fisher Scientific) in pre-warmed supplemented CO2-independent medium and incubated at 37 °C with gentle shaking for 40 min.
-
bioRxiv - Biochemistry 2021Quote: ... The endoplasmic reticulum was stained using an Alexa488-coupled anti-calnexin (1:200, mAb AF18, ThermoFisher Scientific) in 10% goat serum overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... The concentration of the purified mAb was determined using the Coomassie Plus protein assay reagent (Thermo Scientific).
-
bioRxiv - Microbiology 2021Quote: ... Oregon green 488 was first conjugated to mAb 18B7 using Oregon Green 488 Protein Labeling Kit (ThermoFisher). BMDMs were plated at a density of 1.25 × 105 cells/well on 24-well plate with 12 mm circular coverslip ...
-
bioRxiv - Immunology 2021Quote: ... The following primary antibodies (Ab) were used: occludin (mouse monoclonal [mAb], clone OC-3F10, Thermo Fisher Scientific), TFF3 (rabbit polyclonal [pAb] ...
-
bioRxiv - Microbiology 2022Quote: Anti-ORF8 mAb (#1-3-2) was coupled to aldehyde/sulfate latex beads (Thermo Fisher Scientific A37304). The antibody was mixed with the latex beads and shaken at room temperature overnight ...
-
bioRxiv - Immunology 2023Quote: ... The assay for MUC5AC was performed using biotin-conjugated mouse anti-MUC5AC mAb (45M1, Invitrogen, #MA5-12175) as described previously (12) ...
-
bioRxiv - Biophysics 2024Quote: ... The 3 mAbs were specifically conjugated to HRP using EZ-Link™ Plus Activated Peroxidase Kit (ThermoFisher) and detected with ECL (Pierce ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were then incubated (1:500 dilution) with mouse anti-human E-cad mAb (4A2C7, Life Technologies) and anti-human HtrA (PA523395 ...
-
bioRxiv - Microbiology 2023Quote: ... they were stained with a mastermix of anti-cytokine/transcription factor mAbs containing BCL6 PE (ThermoFisher Scientific) at 4 °C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: The following primary antibodies were used: anti-ezrin mouse monoclonal antibody (mAb) (1:500; MA5-13862, Invitrogen); anti-p75 NTR rabbit mAb (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were produced at MAB Discovery GmbH using the FreeStyle™ 293 expression system from Thermo Fisher. Transfected HEK-293 FreeStyle™ cells were incubated for 10-11 days at 37°C ...