Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for GCLC Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The recombinant sACE2 protein was purified by nickel affinity columns (Invitrogen) and ACE2-Fc was purified using Protein A affinity column (Cytiva) ...
-
bioRxiv - Bioengineering 2021Quote: ... human recombinant insulin (10 μg ml-1, Life Technologies, 12585-014), IGF-2 (30 ng ml-1 ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ng/ml mouse recombinant LIF (ES cell-tested) (Gibco #A35935). Upon reaching confluence ...
-
bioRxiv - Cell Biology 2022Quote: ... the recombinant GST-tagged kinase active human mTOR (Cat. PV4753, ThermoFisher) was used instead of the immunoprecitated mTORC1 ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Biochemistry 2022Quote: All recombinant proteins were expressed in Escherichia coli BL21 DE3 (Invitrogen), in LB medium ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 ng/ml human basic FGF recombinant protein (bFGF) (Gibco, 13256029), 2% B27 supplement (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 20 ng/ml human EGF recombinant protein (Gibco, PHG0314), 20 ng/ml human basic FGF recombinant protein (bFGF ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2.5 ng/mL recombinant human hepatocyte growth factor (Gibco, UK).
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Cell Biology 2020Quote: ... PRC1 (mouse mAb IgG2b, clone 16F2, product MA1-846; used at 1/100) was from ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary Strep-MAb classic chromeo-488 (IBA) and secondary Alexa-fluor 488 goat anti-mouse (Invitrogen) were applied sequentially with PBS washes in between ...
-
bioRxiv - Immunology 2021Quote: ... Serial dilutions of the mAb samples were made in 1X minimal essential medium (MEM; Life Technologies) starting at 30 µg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... 5 ul of mAb DG52 pre-coupled to 100 μl Dynabeads™ Protein G (Thermo Fisher) was added to the supernatant and incubated for 1 hr at 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... Chambers were washed 3X with MAB and incubated with anti-mouse Alexa647 (A21236, Thermo Fisher Scientific) secondary antibody for 1.5 hours ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse mAb against cathepsin L (BMS1032) and α-tubulin (T5158) were bought from Thermo Fisher Scientific and Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Goat anti-rat and streptavidin Molecular Probes Alexa-Fluor-488 and 633 conjugated secondary mAbs (Invitrogen) were used at 2µg/ml and all sections were counterstained with DAPI to distinguish cell nuclei ...
-
bioRxiv - Immunology 2021Quote: The IgGs representing the mAbs were produced in either HEK 293T (ATCC) or Expi293 (Thermo Scientific) cells ...
-
bioRxiv - Microbiology 2021Quote: ... monoclonal anti-HAtag antibody (1:8000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) or COVID-19 patient serum (1:200) ...
-
bioRxiv - Immunology 2021Quote: ... The IC50 of the evaluated mAbs was tested by the Varioskan LUX Microplate Spectrophotometer (Thermo Fisher), and calculated by a four-parameter logistic regression using GraphPad Prism 8.0.