Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... mRNA expression was analyzed based on 2-3 biological replicates each with 3 technical repeats using QuantStudio™ Design & Analysis Software (Thermo Fisher Scientific Inc.). The 18S-rRNA housekeeping gene was used as an internal reference gene ...
-
bioRxiv - Neuroscience 2024Quote: Intracellular ROS in BV-2 cells was measured by incubating cells with 1 µM cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Invitrogen, D399) at 37°C for 30 min.
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... All drug treatments were performed for 3 – 5 hours prior to imaging with a final concentration of 5 nM of actinomycin D (Gibco, 11805-017) or 1 µM of BMH-21 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 12 mM 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium (MTT) (Thermo Fisher Scientific, #M6494). After 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: ... and SARS-CoV-2 [3]) was performed with Proteome Discoverer version 2.4 (Thermo Fisher Scientific). The search was restricted to human and SARS-COV-2 proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg of RNA was digested with Turbo DNase (2 U/μl, # AM1907, ThermoFisher Scientific). 500 ng of DNase-digested RNA was tagged with G/I tails in a 10 μl reaction ...
-
bioRxiv - Immunology 2022Quote: ... Cells were activated for 3 days in presence of 100 U/mL IL-2 (Gibco) and 1 µg/mL PHA (Remel).
-
bioRxiv - Microbiology 2021Quote: ... and 2-3 cm) after measuring the DNA concentration with Qubit (QubitⓇ 2.0 Fluorometer, Invitrogen). We obtained eight metagenomes from Lake Sarnen (deepest and shallow_inflow station for March ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... where an Acclaim PepMap 100 (2 cm x 75 μm, 3 μm particles; Thermo Fisher) pre-column was connected in front of an EASY-Spray PepMap RSLC C18 reversed phase column (50 cm x 75 μm ...
-
bioRxiv - Microbiology 2021Quote: ... an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)) assay (M6494, Thermo Fisher Scientific) was conducted in parallel to the infection and kinase inhibitor treatment according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were prepared by incubating with a 2% solution of 3-aminopropyltrimethyoxysilane (313255000, Acros Organics) diluted in isopropanol ...
-
bioRxiv - Biochemistry 2021Quote: ... a pEntryslot3 vector containing the let-858 or tbb-2 3’UTR and pDEST (ThermoFisher) in an LR reaction ...
-
bioRxiv - Cell Biology 2021Quote: siRNA transfections were performed 2 or 3 days before each experiment using Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... All cell lines were passaged every 2-3 days using 0.05% Trypsin/EDTA solution (Gibco).
-
bioRxiv - Systems Biology 2023Quote: ... Cells were subcultured every 2-3 days and transfected with lipofectamine 2000 transfection reagent (Invitrogen) in Opti-MEM medium (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were aspirated and 2-3 crystals of Dil stain (Life Technologies-Molecular Probes) were added to each culture well and incubated on a shaker for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were aspirated and 2-3 crystals of Dil stain (Life Technologies-Molecular Probes) were added to each culture well and incubated on a shaker for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were DNase treated (3 µL of Turbo RNase-free DNase, 2 U/µL, ThermoFisher) for 20 min at 37°C and then precipitated by addition of 290 µL of water ...
-
bioRxiv - Molecular Biology 2024Quote: ... passage 2-3 NPCs were detached with Stempro Accutase cell dissociation reagent (A1110501, Life Technologies) and kept in cold PBS 1%FBS for the duration of the protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... Cytotoxicity was determined by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (ThermoFisher: M6494) reduction analysis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Organoid images were digitally acquired every 2–3 days on an EVOS M7000 (ThermoFisher, AMF7000) with DiamondScope software (version 2.0.2094.0 ...
-
bioRxiv - Immunology 2024Quote: ... 10% heat inactivated fetal bovine serum (HIFBS) 2 × 10-3 m L-glutamine (Life Technologies), antibiotic antimycotic (1× ...
-
bioRxiv - Genomics 2023Quote: ... mESCs were routinely passaged at ∼80% confluency every 2-3 days using TrypLE Express (ThermoFisher). Before experiments ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 ng equivalent was synthesized using Super Script 3 Supermix (18080400, Thermo Fisher, USA) with stem-loop primers and sly actin_R primers as internal controls (Table S2) ...