Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... HCEnCs were rinsed in DPBS and passaged at a ratio of 1:2 or 1:3 with TrypLE (Thermo Fisher Scientific) for 10-15 min at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (2◻×◻10-5 M, ThermoFisher), penicillin (100◻IU◻per ml ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM MEM non-essential amino acids (Life Technologies #11140050), 10 mM HEPES (Life Technologies #15630080) ...
-
bioRxiv - Genomics 2023Quote: ... 2 mM MEM non-essential amino acids (Life Technologies #11140050), 10 mM HEPES (Life Technologies #15630080) ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... Cells were passaged 1:2-1:6 every 2-4 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 µl/cm2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary antibodies were applied for 2 hours in PBS/3% milk powder containing 1 μg/ml Hoechst-33342 (Invitrogen) or DAPI (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... Activated/Cleaved Caspase-3 (1:1000; Cell Signalling Biology, CAT#: 9661S and Thermo Fisher Scientific, CAT#: 66470-2-IG), Nestin (1:1000 ...
-
bioRxiv - Genomics 2023Quote: ... and 100 μg/ml cycloheximide using Beckman Coulter UC tubes 9/16 x 3-1/2 (Fisher Scientific, NC9194790), and equilibrating overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 2 µL streptavidin-HRP (1:5,000; S911, Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Immunology 2023Quote: ... 5x10-5 M 2-mercaptoethanol (2-ME) and 5 mM HEPES (all Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... the filtered supernatant was loaded onto 3-4 mL immobilized D-galactose gel (Pierce™, Thermo Scientific™) equilibrated by gravity flow with Gal A buffer (50 mM Na-phosphate pH 7.4 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated at 4°C for 3 hours on a rotator before being placed in a DynaMag™-2 magnetic rack (Thermo Scientific, 12321D) and washed twice with TBS+NP40 wash buffer ...
-
bioRxiv - Microbiology 2022Quote: ... or in 2 ml liquid MSgg with 7-d-old tomato seedlings in a 6-well plate (Thermo Scientific). Each well contained one seedling ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Physiology 2020Quote: ... Slides were rinsed in PBS 3×5min and then incubated for 1h at room temperature in goat anti-rabbit AF647 (1/250, 21245, Life Technologies) or donkey anti-goat AF647 (1/500 ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM L-glutamine (Cytiva SH30024) supplemented with 1% nonessential amino acids (Gibco 11140-050) and 10% FBS (Corning 35-011-CV ...
-
bioRxiv - Bioengineering 2024Quote: ... Caco-2 cell medium was also supplemented with 1% nonessential amino acids (Thermo Fisher Scientific). Cells were seeded with a density of 300.000 cells/mL DMEM ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Cell Biology 2022Quote: ... CellEvent Caspase 3/7 Green Detection Reagent was obtained from Thermo Fisher Scientific and used according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2022Quote: ... HUVECs (passages 3-7) were washed with phosphate-buffered saline (PBS, ThermoFisher) and detached by trypsin/EDTA solution (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... Apoptosis was assessed using the CellEvent Caspase-3/7 Detection Reagent (Invitrogen) over TCB-treatment duration or at specific intervals ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the QuantStudio 3 and 7 Real-Time PCR systems (Applied Biosystems).
-
bioRxiv - Cell Biology 2024Quote: Vacuolar pH alterations were detected using the 5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA, Invitrogen) probe ...
-
bioRxiv - Neuroscience 2020Quote: ... Some slices (used for experiments in Fig. 2 and 3) were cultured in media that included 2 % B-27 Supplement (Thermo Fisher Scientific). Slices were maintained at 37°C and 5 % CO2 and used for experiments at DIV10-15.
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 2-3 hours at room temperature with 2 µg/ml donkey anti-goat Alexa Fluor 488 (Cat# A21206, Thermo Fisher Scientific), 2 µg/ml donkey anti-rabbit Alexa Fluor 568 (Cat# A10037 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2’,7’-dichlorofluorescein (DCF, D399) was purchased from Invitrogen. Halt™ Protease and Phosphatase Inhibitor Cocktail (EDTA-free ...
-
bioRxiv - Microbiology 2024Quote: ... and 2’,7’-dichlorofluorescein diacetate (Thermo Fisher Scientific, D399) was added at a final concentration of 100 µM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dimethyl sulfoxide (DMSO) and 7-hydroxycoumarin were purchased from Fisher Scientific. Hydroxybupropion-d6 was purchased from Cambridge Isotope Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI) and appropriate secondary antibodies conjugated to fluorochromes (Thermo Fisher Scientific) were applied for 1 hour at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... 5×10-5 M 2-mercaptoethanol (Gibco) and 50µg/mL Gentamicin (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of T cells at a 1:1 effector:target cell ratio in the presence of the caspase-3/7 Green Detection Reagent (Invitrogen). Images were taken every 2 h at 10× magnification ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA expression was analyzed based on 2-3 biological replicates each with 3 technical repeats using QuantStudio™ Design & Analysis Software (Thermo Fisher Scientific Inc.). The 18S-rRNA housekeeping gene was used as an internal reference gene ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...