Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... all used viruses were propagated to passage 3 on Calu-3 (ATCC HTB-55) cells in Advanced DMEM/F12 (Gibco), supplemented with HEPES ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Neuroscience 2023Quote: ... and loaded with the Fluorescent Dye-Based Rhod-3 AM following the manufactures’ instructions (Rhod-3 Calcium Imaging Kit, Cat.No. R10145; ThermoFisher scientific). Loading ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Neuroscience 2023Quote: ... a 5040 amperometric cell and a Hypersil Gold C18 analytical column (3 μm, 100 × 3 mm; Thermo Fisher Scientific, USA). The mobile phase consisted of 0.1 M KH2PO4 buffer at pH 3.8 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Genomics 2023Quote: ... A single-cell suspension from PBMC from each patient was quantified and analyzed for viability using the Cell counter 3 (Countess 3, Invitrogen) and then loaded onto the 10X Genomics Chromium Single Cell Controller for isolation of single cells (10X Genomics) ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 activity was assessed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Scientific, #C10427) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Cat. A638729) were purchased from Aladdin (Shanghai). KLH (Cat. 77600) was purchased from ThermoFisher. Peptide synthesis was conducted by Genscript (Nanjing ...
-
bioRxiv - Immunology 2019Quote: ... rabbit anti-keratin 14 (KRT14, RB-9020-P0, Thermo Fisher, Waltham, MA; 1:500), rat anti-mouse CD68 (FA-11 ...
-
bioRxiv - Immunology 2021Quote: ... anti-p24 mAb (AG3.0) and anti-GAPDH mAb (Life Technologies) followed by goat anti-mouse HRP-conjugated second antibody (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... anti-p24 mAb (AG3.0) and anti-GAPDH mAb (Life Technologies) followed by goat anti-mouse HRP-conjugated second antibody (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μL lipofectamine RNAiMax (ThermoFisher, Cat No. 13778030) were diluted in 50 μL Opti-MEM (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified DNA was quantified using Qubit-3 (Invitrogen) and 10-100 ng of total DNA was used for library preparation using the KAPA Hyper Prep kit (KAPABiosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... The GeneChip 3’ IVT PLUS Reagent Kit (Affymetrix/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... on Falcon 3 (Thermo Fisher Scientific-FEI, NL) camera operated in counting mode at an angular range of -60 ° to 60 ° in a bidirectional fashion and at an angular increment of 2° ...
-
bioRxiv - Genetics 2021Quote: ... and 3 x phosphatase inhibitor (Thermo Scientific, #78420)-supplemented RIPA buffer (bioWORLD ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with fluorescein (3 μM) (Thermo Fisher Scientific), which served as a FAM and protein only control ...
-
bioRxiv - Molecular Biology 2019Quote: ... QuantStudio 3 Real-Time PCR System (Applied Biosystems) was used ...
-
bioRxiv - Developmental Biology 2019Quote: ... or NuPAGE 3-8% Tris-Acetate Gels (Invitrogen) and transferred to Immun-Blot PVDF membrane (Bio-rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... qPCR was performed using QuantStudio 3 (ThermoFisher Scientific) with SYBR green Platinum™ SYBR™ Green qPCR SuperMix-UDG (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... CCCTCAGACACATCCTC with a 3’ MGB quencher (Taqman, Invitrogen), Forward primer ...
-
bioRxiv - Bioengineering 2019Quote: Cells were fixed with 3% PBS – paraformaldehyde (ThermoFisher) for 20min at room temperature and subsequently washed three times with PBS ...
-
bioRxiv - Bioengineering 2019Quote: ... TOPRO-3 (1:1000, in PBS) (Invitrogen, USA) was used for 15 min at room temperature to stain the nuclei.
-
bioRxiv - Developmental Biology 2019Quote: ... and quantified using a Qubit 3 Fluorometer (Invitrogen). cDNA was generated with 400ng of RNA with iScript RT Supermix for RT-qPCR (BioRad) ...
-
bioRxiv - Immunology 2019Quote: ... anti-CD3 (25ng/mL clone OKT-3, Invitrogen) and anti-CD28 (25ng/mL ...
-
bioRxiv - Biophysics 2019Quote: ... A real-time thermocycler QuantStudio 3 (ThermoFisher, USA) was used for collecting data from 20 to 80 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... and CellEvent caspase-3/7 reagent (ThermoFisher Scientific) were used according to manufacturer protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Genetics 2021Quote: ... and mixed with 3 μl Lipofectamine RNAiMAX (ThermoFisher) diluted in 47 μl Opti-MEM I ...
-
bioRxiv - Genetics 2021Quote: ... 8ul of 1:3 Vectashield (Thermo Fisher Scientific) DAPI:PBS was added to samples and allowed to incubate for 5 min ...