Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... on a QuantStudio 3 (Applied Biosystems, USA). Relative expression was calculated for each gene by the 2-△△CT method ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times with 1x MEM (Gibco) and digested under stirring with 0.25% trypsin ten times ½ an hour each ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-3 L of Expi293F cells (ThermoFisher) were grown at 37°C to a cell density of 3.2×106 cells/mL in FreeStyle expression medium (ThermoFisher) ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Cell Biology 2024Quote: ... and caspase 3/7 (Thermo Fisher Scientific) were prepared following the manufacturer instructions ...
-
bioRxiv - Immunology 2024Quote: ... a 3-laser Attune NxT (ThermoFisher Scientific), or a 5-laser Aurora (Cytek Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: ... and TO-PRO-3 (1:5000, ThermoFisher). The combination of Nucred Dead 647 and TO-PRO-3 has previously been described by Dekkers et al24 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Blasticidin (Thermo Fisher; 3 ug/mL) for 48 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... or Goat αMouse Cy-3 (Invitrogen, #A10521) (1:500) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3’-Diaminobenzidine (DAB, Acros Organics, Pittsburgh, PA), washed with water ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 3-8% Tris-Acetate gels (Invitrogen) and transferred onto PVDF membranes using a wet blot system for 1 h at 100 V (Biorad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 3% FBS (Gibco BRL Invitrogen), 0.3 µg/ml liberase (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 3% FBS (Gibco BRL Invitrogen), 0.3 µg/ml liberase (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... on a QuantStudio 3 System (Applied Biosystems) with reaction specificity confirmed by melt curve analysis ...
-
bioRxiv - Genetics 2023Quote: ... diluted 1:3 in 1X PBS (Gibco). Trypsin was inactivated by cell media.
-
bioRxiv - Cell Biology 2024Quote: ... blocked with 3% BSA (BP9703100, Fisher Scientific) in PBST (DPBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3% H2O2 (Fisher Scientific 7722-84-1) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... Ki-67 recombinant rabbit monoclonal antibody (SP6) (Thermofisher, Cat. #: MA5-14520), Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2020Quote: ... We used GFP recombinant rabbit monoclonal antibody (G10362, Thermo Fisher Scientific) at 1:300 dilution and monoclonal anti-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Endoplasmic reticulum (ER) was labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, aka DiIC18(3)) (Thermo Fisher #D282) or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Neuroscience 2019Quote: ... cortical cultures were loaded with fluo-4 AM (3 μM) or fura-2 AM (3 μM) plus 0.1% Pluronic F-127 (ThermoFisher) in a HEPES-buffered saline solution (HCSS ...
-
bioRxiv - Biochemistry 2020Quote: Cultivated Jurkat cells were collected and washed 3 times in flow buffer (PBS without Ca/Mg, 3% FBS, Gibco). Cell concentration was measured ...
-
bioRxiv - Cancer Biology 2020Quote: ... TIC-enriching 3-D cultures (3-D) were maintained in stem cell media: DMEM:F12 (+ L-glutamine, + 15 mM HEPES) (Gibco) supplemented with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were run on the QuantStudio 3 and analyzed on the QuantStudio 3 Design and Analysis software v1.5.1 (ThermoFisher Scientific). Quantitation and normalization of relative gene expression were accomplished using comparative threshold cycle method or ΔΔCT.
-
bioRxiv - Cell Biology 2021Quote: Total RNA from control (n=3) and model (n=3) Huh7 cells were isolated by TRIZOL reagent (Thermo Scientific), and the RNA concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then lysed and a caspase-3 assay was performed according to the manufacturer’s protocol (EnzChek caspase-3 Assay, Invitrogen). The intensity of fluorescence was analyzed using an EnVizion plate reader.
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Developmental Biology 2020Quote: RNA from Rbx2 fl/fl (n=3) and Rbx2cKO-Nes (n=3) P1 telencephalons was extracted using TRIzol (Invitrogen). Strand-specific and barcode-indexed RNA-seq libraries were generated from 1 μg total RNA each after poly-A enrichment using the Kapa Stranded mRNA-seq kit (KapaBiosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Bioengineering 2019Quote: ... The resulting VH-(G4S)3-VL ScFv fragment was further fused at the N-terminus of the murine TNF gene through a S4G-linker and the final construct VH-(G4S)3-VL-(S4G)3-TNF was then cloned into the mammalian expression vector pcDNA3.1 (+) vector (Invitrogen). A VH-(G4S)3-VL ScFv fragment specific for hen egg lysozyme (KSF)(34) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the human dystrophin 3′ UTR or mutant 3′ UTR and with 50 nM miR-146a mimic (Life Technologies) with Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... 40 μl of total blood were stained with a fluorescent lipophilic dye (3, 3′-dyhexiloxacarbocyanine iodide; DiOC6, Molecular Probes) to obtain absolute counts of erythrocytes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3′-ligated RNA fragments and subtracted 3′-ligated RPF fragments were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) at 48 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: Total mRNA from 3 CT-PAK2EC and 3 KO-PAK2EC average-sized tumors was extracted using TRIZOL reagent (Invitrogen) according to recommended procedures ...