Labshake search
Citations for Thermo Fisher :
6451 - 6500 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.5 in 1X PBS then treated with 400 μg/ml sulfo-N-hydroxysulfosuccinimide-biotin (Thermo Fisher Scientific) prepared in the washing buffer for 40 min on an orbital shaker at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 5) at one month of age by homogenizing posterior eyecups in TRIzol (Thermo Fisher) using a gentleMACS dissociator (Milteny Biotec) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells that became adherent during the differentiation process were detached using cell dissociation buffer (Invitrogen, cat n°13151014) and pooled with non-adherent cells ...
-
bioRxiv - Immunology 2019Quote: Bacterial cultures were incubated O/N in a 5 μM solution of Draq5 Fluorescent Probe Solution (ThermoFisher Scientific). Bacterial suspensions were washed 3 times with PBS before RAW264.7 macrophages were infected.
-
bioRxiv - Biochemistry 2020Quote: ... were coated with 5 μg/mL anti-DPEEAE neoepitope antibody (Cat n. PA1-1748A, Life Technologies, Paisley, UK) in carbonate buffer pH 9.6 (16 h ...
-
bioRxiv - Microbiology 2021Quote: ... with SARS-CoV-2 N-specific primers (EV Table 1) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was performed in parallel using purified SARS-CoV-2 viral RNA ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was isolated from fly heads (n=15 per condition) using TRIzol reagent (Thermo Fisher Scientific, 15596026) and quantified on NanoDrop 2000c (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... The first strand was reverse transcribed with primer FR26RV-N using Superscript III enzyme (Life Technologies, Carlsbad, CA), followed by complementary strand synthesis using Sequenase polymerase (Affymetrix ...
-
bioRxiv - Biochemistry 2022Quote: ... Individual samples were then labeled with isobaric tags using commercially available TMTsixplex (Thermo Fisher Scientific, P/N 90061) kits ...
-
bioRxiv - Bioengineering 2022Quote: ... carrying an additional GS linker in the N-terminus were chemically synthesised (Invitrogen, by Thermo Fisher Scientific UK) and annealed ...
-
bioRxiv - Bioengineering 2022Quote: ... carrying an additional GS linker in the N-terminus were chemically synthesised (Invitrogen, by Thermo Fisher Scientific UK) and annealed ...
-
bioRxiv - Microbiology 2021Quote: Cell free glycosylation was conducted in S30 buffer with 0.1% n-dodecyl-β-d-maltopyranoside (DDM; Thermo Scientific) and 10 mM MnCl2 (Across Organics) ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 mM MgCl2) with 1.5% n-Dodecyl β-D-maltoside (DDM) and 1X Halt Protease Inhibitor (Thermo Scientific) for 30 minutes on ice ...
-
bioRxiv - Plant Biology 2020Quote: Venus was fused to either the C or the N terminus of Pit using the Gateway system (Invitrogen). The Pit-Venus ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Samples of the visceral yolk sac (n=6/group) were immersed in RNA Later solution (Invitrogen, MA, USA) and frozen at −20°C until further processing ...
-
bioRxiv - Immunology 2020Quote: ... activated for 30 min on a rotor at RT by addition of Sulfo-N-Hydroxysulfosuccinimide (Thermo Fisher Scientific) and 1-Ethyl-3-(3-dimethylaminopropyl ...
-
bioRxiv - Molecular Biology 2020Quote: RT-RCA was performed in 20 µL with Maxima H Minus Reverse Transcriptase (Thermo Fisher, cat n°EP0752) under the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... RPFs were generated by treating the diluted lysate with 12.7 U of RNase I (Ambion, cat. n°AM2295) at room temperature for 45 min (as described in Clamer et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... the CDS of RFP with a N-terminal AvrII restriction site was amplified and cloned into pDONR221 (Invitrogen) generating a pEntry clone ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the MS was calibrated using ESI Negative on Calibration Solution (P/N 88324, Thermo Scientific, San Jose, USA).
-
bioRxiv - Biochemistry 2021Quote: ... The N-terminal 8xHis-TwinStrep-GFP-tagged NKCC1 constructs were expressed in GripTite HEK293 MSR cells (Thermo Fisher) in 24 well plates ...
-
bioRxiv - Cell Biology 2020Quote: ... Inserts were then subcloned into pCS2+ N’ HA tagged vectors that had been converted into Gateway® (Invitrogen) destination vectors ...
-
bioRxiv - Cell Biology 2019Quote: ... was neutralized with reconstitution buffer (2.2% NaHCO3, 0.05 N NaOH, and 200 mM HEPES) and diluted with 5× DMEM (Gibco). MDCK cells (1.5 × 105 cells/ml of collagen gel ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... in six-well feeder-free culture dishes coated with 5 μg/mL vitronectin (VTN-N; Thermo Fisher Scientific). When seeding the cells ...
-
bioRxiv - Immunology 2021Quote: ... or for intracellular expression using the pYES2/NTC vector (N-terminal Xpress and C-terminal V5 epitope, Invitrogen). The pYD1 system used the yeast internal Apa1/Ap2 system ...
-
bioRxiv - Immunology 2021Quote: ... Tryptic peptides (2μg) were loaded onto a C18 trap (75μm x 2cm; Acclaim PepMap 100, P/N 164946; ThermoFisher) at a flow rate of 2μL/min of solvent A (0.1% formic acid in LC-MS grade H2O) ...
-
bioRxiv - Molecular Biology 2021Quote: ... N-terminal amino acid sequencing was performed using the Procise 494HT Edman sequencer (Applied Biosystems, Foster City, CA) with 610A data analysis module ...
-
bioRxiv - Neuroscience 2020Quote: ... N-glycopeptides from two enrichment methods were combined and desalted by C18 tips (Thermo Fisher Scientific, Cat #87784) following the manufacturer’s instructions and resuspended in 30 μL 100 mM TEAB buffer ...
-
bioRxiv - Genetics 2020Quote: ... Purified N-HIS-FAM19A5 was then digested overnight at 30°C with AcTEV protease (Thermo Fisher Scientific, USA) to remove the His-tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... U251(N) and primary GBM cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) high glucose (GibcoTM, ThermoFisher) with 10 % FBS (P30-3031 ...
-
bioRxiv - Neuroscience 2022Quote: ... hiPS cells were maintained in 6-well plates coated with recombinant human vitronectin (VTN-N, Life Technologies, A14700) in Essential 8 medium (Life technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse brains and CV-1 fibroblasts were lysed using N-PER Neuronal Protein Extraction Reagent (ThermoFisher catalog # 87792). Samples were resolved by SDSPAGE using 10% acrylamide/bis-acrylamide gels and transferred to 0.2 μm pore size nitrocellulose (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The tissues were individually homogenized with N-PER™ Neuronal Protein Extraction Reagent (Cat. #: 87792, Thermo Fisher Scientific) containing Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Coverslips were subsequently mounted on glass microscopy slides using Fluoromount G (Thermo Fisher, cat n°00-4958-02).
-
bioRxiv - Neuroscience 2022Quote: ... Sections were subsequently mounted on glass microscopy slides with Fluoromount G (Thermo Fisher, cat n°00-4958-02).
-
bioRxiv - Cell Biology 2022Quote: ... bone slices with a thickness of 0.2mm (BoneSlices.com) were labelled with N-hydroxysuiccinimide ester-activated Rhodamine fluorescent dye (ThermoFisher). Mature osteoclasts were seeded at a density of 100,000 cells/bone slice in a 96-well plate ...
-
bioRxiv - Bioengineering 2022Quote: ... in IMDM/F12 medium supplemented with 1% (v/v) N-2 (Thermo Fisher Scientific, catalogue no. 17502-048), 1% (v/v ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
bioRxiv - Biochemistry 2024Quote: ... Individual samples were then labeled with isobaric tags using commercially available TMTsixplex (Thermo Fisher Scientific, P/N 90061) kits ...
-
bioRxiv - Immunology 2023Quote: ... After the indicated time cells were lysed in 1% n-Dodecyl-β-D-Maltoside (DDM, Thermo Scientific #89903) in lysis buffer (30 mM Tris pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: SK-N-SH cells were first transfected with 20 nM of siRNA against TSG101 using Lipofectamine RNAiMAX (Invitrogen). At 48 h post-transfection of siRNA ...
-
bioRxiv - Neuroscience 2022Quote: Whole mouse brains were homogenized with a Dounce tissue grinder in neuronal protein extraction reagent (N-PER) (ThermoFisher) containing protease/phosphatase inhibitors (Cell Signaling #5872) ...
-
bioRxiv - Microbiology 2022Quote: ... was synthesized as a custom peptide with N-terminal acetylation and C-terminal amidation (Life Technologies Europe Bv).
-
bioRxiv - Molecular Biology 2023Quote: ... Human PKCβII was YFP-tagged at the N-terminus in a pcDNA3 vector using Gateway Cloning (Life Technologies) as described in (6) ...
-
bioRxiv - Neuroscience 2023Quote: ... hiPSCs were maintained in six-well plates coated with recombinant human vitronectin (VTN-N, Thermo Fisher Scientific, A14700) in Essential 8 medium (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... In vitro transcribed RNA of SARS-CoV-2 N-gene was synthesized with MEGAscript T7 (Thermo Fisher Scientific) using PCR product generated from SARS-CoV-2 WA1 cDNA and primers N0.5_F and N3-5_R (Eurofins ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: Primary human parenchymal lung fibroblasts from non-COPD and COPD patients (n=8) were grown in DMEM (Gibco) supplemented with 5% FBS and 2% antibiotics at 37°C and 5% CO2 ...