Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The gene-specific forward/reverse primers used for 96-well RT-qPCR experiments with PowerUp Green Master Mix (Applied Biosystems) are listed in ESM Table 3 ...
-
bioRxiv - Genetics 2020Quote: ... reference primers/probe (VIC, TaqMan™ Copy Number Reference Assay, human, RNase P, 4403326; ThermoFisher, Waltham, MA)] and applied to a X200™ Droplet Generator (1864002 ...
-
bioRxiv - Microbiology 2021Quote: ... 5μl were used for quantitative PCR with primer/probe sets for human GAPDH (Applied Biosystems Cat# Hs99999905_m1) and HIV-1 genomic RNA (primers GGCCAGGGAATTTTCTTCAGA / TTGTCTCTTCCCCAAACCTGA (forward/reverse ...
-
bioRxiv - Neuroscience 2023Quote: ... Exogenous mRNA levels of transgene expression human APOE (Hs00171168_m1) commercial TaqMan® primer/probe set (Applied Biosystems). Endogenous mouse Beta-Actin (Mm02619580_g1 ...
-
Loss of TMEM55B modulates lipid metabolism through dysregulated lipophagy and mitochondrial functionbioRxiv - Cell Biology 2024Quote: ... TMEM55B was quantified using a Taqman primer (Hs00292741 for human and Mm01319582_m1 for mouse) from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the human dystrophin 3′ UTR or mutant 3′ UTR and with 50 nM miR-146a mimic (Life Technologies) with Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Ascl2 and Actin-beta (Thermo Fisher Scientific). Single cells were collected directly into 96-well plate by flow cytometry (MoFlo ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-beta actin (1:5000, Invitrogen). Then ...
-
bioRxiv - Bioengineering 2020Quote: ... with 5% beta-mercaptoethanol (BME; Fisher Scientific), were subjected to SDS-PAGE using NuPAGE™ 4-12% Bis-Tris Gels (Invitrogen ...
-
bioRxiv - Systems Biology 2020Quote: ... and mouse anti-beta-actin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... 50 μM beta-mercaptoethanol (Gibco, MD, USA), 1 mM sodium pyruvate (Hyclone ...
-
bioRxiv - Genetics 2022Quote: ... 55 uM beta-mercaptoethanol (ThermoFisher 21985-023), and 1000 U/mL mouse leukemia inhibitory factor (mLIF ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 mM beta-mercaptoethanol (Thermo Fisher Scientific), and 10 ng/ml leukaemia inhibitory factor (produced in-house) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.5 mM beta-mercaptoethanol (Life Technologies). Drosophila S2 (SG4 ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 mM beta-mercaptoethanol (Life Technologies) (R10 medium) ...
-
bioRxiv - Immunology 2020Quote: ... 50 µM beta-mercaptoethanol (Gibco, 21985-023), 1 mM sodium pyruvate (Hyclone ...
-
bioRxiv - Immunology 2020Quote: ... 50 μM beta-mercaptoethanol (Gibco, 21985-023), 1 mM sodium pyruvate (Hyclone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beta-mercaptoethanol (Fisher scientific, 44-420-3250ML), NaHCO3 (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... and 2 mM beta-mercaptoethanol (Life Technologies). Cells were stimulated with 50 IU/ml IL-2 (Proleukin ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-beta-actin (Invitrogen, 15739-BTIN). Chemiluminescent (32106 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 uM Beta-mercaptoethanol (31350010, ThermoFisher Scientific), 1X Non-Essential amino acids (11140050 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2 % beta-mercaptoethanol (Thermo Fisher, 31350-010), 1 % Pen/Strep (ThermoFisher ...
-
Loss of intermicrovillar adhesion impairs basolateral junctional complexes in transporting epitheliabioRxiv - Cell Biology 2024Quote: ... anti-Beta-Catenin (rabbit, Invitrogen #71-2700), 1:100 ...
-
bioRxiv - Systems Biology 2024Quote: ... 0.1 mM beta-mercaptoethanol (Gibco™ 31350010) and 500 U/mL recombinant leukemia inhibitory factor (LIF ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.1% beta-mercaptoethanol (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... and 50µM beta-2- mercaptoethanol (ThermoFisher Scientific). The next day drug concentrations were increased to 10μg/ml puromycin (Invivogen ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM beta-mercaptoethanol (Gibco, 31350-010), penicillin/streptomycin (Biological Industries ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.5ml beta-mercaptoethanol (Invitrogen, #21985-023) with 4ug/ml Doxycycline (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... beta- mercaptoethanol (Gibco, Cat#21-985-023), MEM NEAA (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: ... beta Actin Polyclonal Antibody (Invitrogen™ PA116889), beta Tubulin Polyclonal Antibody ...
-
bioRxiv - Microbiology 2024Quote: ... beta- actin(Life Technologies # MA5-15739-HRP), mouse pMLKL (abcam # ab196436 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 50 mM of beta- mercaptoethanol (Gibco) at 37 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... 50 μM beta-mercaptoethanol (Gibco, 21985-023), 1 mM sodium pyruvate (Hyclone ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.1 mM beta-Mercaptoethanol (Gibco, #3150-010) and 1000 U/ml Leukemia Inhibitory Factor (LIF ...
-
bioRxiv - Cancer Biology 2024Quote: ... beta-mercaptoethanol (100 uM, Gibco, 31350-010), MEM non-essential amino acids (Gibco,11140-035) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Organoids were thereafter exposed to 10 ng/ml TGF-β1 (Thermo Fisher) overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... and 14 days in complete media containing 5ng/ml TGF-β (Thermofisher). The samples were retrieved after the respective culture period and fixed in 4% paraformaldehyde ...
-
bioRxiv - Cell Biology 2024Quote: ... and molecular drivers of disease including TGF-β1 (Thermo Fisher Scientific, PHG9214) and Lipopolysaccharide (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... + 100 mM beta-mercaptoethanol at 80 °C for 10 min and run on 3-8% Tris-acetate gels (Thermo Fisher Scientific, EA0375PK2). Gels were run at 80V for 3 h and transferred onto a PVDF membrane in Tris-Glycine buler for 90 min at 90V ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Biochemistry 2024Quote: ... using the restriction enzyme pairs NcoI/XhoI (Thermo Scientific) to generate C-terminal Strep Tag II affinity tags ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR assays were performed with a QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). The calibration curves for the targeted genes were constructed using serial dilutions of PCR2.1™ vectors (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... The RT-qPCR were performed in the QuantStudio® 3 Real-Time PCR System (Applied Biosystems) using the SYBR® Green detection system ...
-
bioRxiv - Immunology 2022Quote: ... qPCR analysis was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA) using a Radiant qPCR mastermix (Alkali Scientific ...
-
bioRxiv - Physiology 2021Quote: ... qPCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The Actb gene was used as an internal control.
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was carried out on a QuantStudio 3 or QuantStudio 5 Real-Time PCR System (ThermoFisher) with a passive reference of ROX using the following cycling conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... qPCR analysis was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA) using a Radiant qPCR mastermix (Alkali Scientific ...