Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2023Quote: ... and incubated for a period of 1 h in a dark room in 2 ml of extracellular solution containing 5 µM fluo- 4 AM (Thermo Fisher Scientific) or 7 µM Corona Green AM (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 to 4 µL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 µm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of cells were collected by centrifugation at 1500 rpm for 5 min at 4°C and stained with anti-SARS-CoV-2 RBD antibody (Invitrogen, PA5-114529). After centrifugation ...
-
bioRxiv - Immunology 2024Quote: ... Cell concentrations were assessed by acquiring 30 μL of resuspended cells diluted 1:5 in PBS-4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) without any prior washing steps ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Cell Biology 2024Quote: Cells (2 – 5 x 106) were washed two times with cold PBS and lysed with RIPA buffer at 4°C (Thermo Fisher Scientific) supplemented with protease inhibitor (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... and L plasmids at a ratio of 4:2:2:2:1 using Lipofectamine 2000 (ThermoFisher Scientific). Cells were transfected in 6 well plates and subsequently transferred to T25 flasks with HEp2 cells until cytopathic effect (CPE ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Immunology 2021Quote: ... Glucose uptake was measured by the uptake of glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG, Life Technologies). Cell surface and intracellular cytokine stainings of splenocytes and blood lymphocytes were performed as described (42) ...
-
bioRxiv - Physiology 2020Quote: ... 1 mM fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Life Technologies) was diluted in Live Cell Imaging Solution (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: Cellular glucose uptake was measured by culturing cells in glucose free DMEM for 2 hours before adding 100µM of the fluorescent glucose analogue 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher, N13195). The analogue was incubated with MCF7s for 30 minutes and MSCs for 60 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 vein graft slide containing 2-4 cross sections was double stained with the general macrophage marker Mac-3 (rat anti-mouse, Fisher Scientific, B550292, 1:600) and either iNOS (rabbit anti-mouse ...
-
bioRxiv - Immunology 2024Quote: ... differentiated Th2 cells were restimulated with anti-mouse CD3 (4 µg/mL) for 3 hours followed by 2 hours of incubation with monensin (Thermo Fisher Scientific, MA, USA) at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were washed (5 min at RT x 3 times) in PBS and incubated (overnight at 4°C) with streptavidin-Alexa 488 (ThermoFisher Scientific, S-11223, 1:500) in PBS-triton 0.05% ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... EdU 10μM (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific) diluted in fresh medium was added in the well for 10 minutes (MIA PaCa-2) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... loaded with 5 μM Rhod-2,am (ThermoFisher) in a zinc-containing HEPES-based salt solution (HBSS ...
-
bioRxiv - Molecular Biology 2021Quote: ... EdU (5-ethynyl-2’-deoxyuridine, Invitrogen, cat# A10044) was dissolved in PBS at 0.5 µg/µl and injected intraperitoneally into mice at 5 µg/g body weight 24 h before harvesting ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’– deoxyuridine (27) (Invitrogen, Cat# A10044) was administered through drinking water (0.5mg/ml) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3μM EdU (5-ethynyl-2′-deoxyuridine, A10044 Invitrogen) was added to the culture for 48h in the following time window ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mL N-2 Supplement (Thermo Fisher 17502048). Long-Term Glioma Organoid Medium and Short-Term Glioma Organoid Medium stocks were used up to 2 months and 1 week after preparation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of 5 mM DSSO (Thermo Fisher) in 10% DMSO ...
-
bioRxiv - Neuroscience 2023Quote: ... we add EdU (5-ethynyl-2’-deoxyuridine; Invitrogen), a direct measure of de novo DNA synthesis ...
-
bioRxiv - Cancer Biology 2023Quote: ... EdU (5-ethynyl-2’-deoxyuridine) was from Invitrogen. Formaldehyde and paraformaldehyde were obtained from Sigma and Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2023Quote: EdU (5-Ethynyl-2′-deoxyuridine, Life technologies A10044) was administered as previously described 63 ...
-
bioRxiv - Microbiology 2022Quote: ... 5-diphenyl-2-H-tetrazolium bromide) assay (Invitrogen) was performed to follow the proliferation of KO-SFPQ or siSFPQ HCT116 cells compared to WT or siCtrl HCT116 cells respectively ...
-
bioRxiv - Biophysics 2023Quote: ... 2 μl 5× first strand buffer (ThermoFisher Scientific), 1 μl 10 μM reverse primer (miR_tail_RT ...
-
bioRxiv - Microbiology 2023Quote: ... every 2–5 days in complete media (Gibco): growth factor-supplemented DMEM/F12 with high glucose media with 10% FCS ...
-
bioRxiv - Neuroscience 2023Quote: ... consisting of 5% 2-mercaptoethanol (ThermoFisher Scientific; USA). 40ug of each sample was denatured at 95°C for 5 minutes and loaded in 4–20% Mini-PROTEAN® TGX™ Precast protein gels (Bio-Rad ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 2-5 μg/ml Blasticidin S (Life Technologies), or 0.9 μM DSM1 (BEI Resources ...
-
bioRxiv - Immunology 2024Quote: ... anti-ɑ-tubulin (B-5-1-2; Invitrogen), Alexa Fluor 488 anti-acetylated tubulin (6-11B-1 ...
-
bioRxiv - Cell Biology 2024Quote: ... BrdU (5-bromo-2’-deoxyuridine) (11594167, Invitrogen™) was administered 6h later i.p ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
bioRxiv - Genomics 2022Quote: ... 3 μM CHIR99021 (Stemgent) and 0.5× N-2 Supplement (Gibco)) which was changed daily for the cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were purified 2-3 times by Trizol LS (Ambion) to completely remove the carry over plasmid DNA template ...
-
bioRxiv - Neuroscience 2024Quote: ... with passaging every 2-3 days with trypsin/EDTA (Gibco). 3 biological replicates were generated for proteomic analysis ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...