Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and 2 ng/ml BMP-4 (ThermoFisher Scientific). Then ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of MVs were incubated with the FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Thermofisher) at 2 µg/mL in a final volume of 100 µL in a 96-well black plate ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 in GFD medium supplemented with 5 mM L-glucose and 1 mM 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG; Invitrogen). Finally ...
-
bioRxiv - Cell Biology 2024Quote: Cells were transfected and 24h later treated with 250µM or 500µM of glucose fluorescent analogue 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (#N13195, Thermofisher) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Microbiology 2020Quote: ... The sporozoite-infected culture was maintained for 3 or 5 or 7 days after which the cells were fixed with 4% paraformaldehyde (ThermoFisher Scientific: catalogue number 28906) for 10 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 5 mg/ml linear acrylamide (Ambion), 600 μl of preheated (65°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Ca2+-indicator Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Neuroscience 2024Quote: ... 1∼5 mM in the Fluo-4(F14201, Invitrogen) form of Powder ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Physiology 2024Quote: ... only 4 wells of cells were incubated in DMEM with 4 μM fura-2/AM (fura-2/AM, Molecular Probes, USA) at 37° C in the dark for 45 min ...
-
bioRxiv - Genetics 2022Quote: ... 2.5 volume of Ethyl alcohol and 1μl GlycoBlue (Invitrogen TM, AM9516) and DNA was dissolved in 1×TE buffer (10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 2 μM cell-permeant Fluo-4 acetoxymethyl ester (Fluo-4-AM, Thermo Fisher) with the addition of the equal quantity (1:1 v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... followed by 3 mL of methanol (Fisher Scientific; Cat #A454-4), and 600 µL of 3% HCl (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and the [4– 3] destination vector (pCFJ201) using LR clonase (Invitrogen). Plasmids were inserted into the worm genome as a single copy using the MosSCI technique (Frøkjaer-Jensen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.05% Trypsin-EDTA (Gibco), and after a few passages ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Biophysics 2023Quote: ... with 3% (v/v) acetonitrile (Thermo Fisher, Cat. No. A996SK-4) and B was 100% acetonitrile ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Neuroscience 2022Quote: ... free floating NAc sections were first washed (3 × 5 min) in 1x PBS containing 2% Triton X-100 (PBST) (Thermo Fisher, Waltham, MA). Sections were then blocked in 5% normal goat serum (NGS ...
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Immunology 2022Quote: The production of NO was evaluated using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA)(D23844; Invitrogen, Waltham, MA). Following leukocyte isolation ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 4-5 times in PBS for 2 hours and mounted onto glass slides using ProLong Gold Antifade Mountant (Invitrogen; Cat #P36930). Sections were imaged on a Leica SP8 upright confocal laser scanning microscope using a X10/NA 0.45 objective ...