Labshake search
Citations for Thermo Fisher :
6201 - 6250 of 10000+ citations for FabFc ZAP rat Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The TA Cloning Kit (Invitrogen) was used for cloning of the amplification product (281bp ...
-
bioRxiv - Microbiology 2021Quote: ... using the KinaseMax kit (Ambion) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: Tyramide SuperBoost kit (Invitrogen, USA) was used to amplify signals in co-stained tissues as per manufacturers protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... using Bioprime labelling kit (Invitrogen). 100 ng Xist fragment was added to 20 μl 2.5X random primer buffer and 9 μl nuclease free water ...
-
bioRxiv - Cell Biology 2021Quote: ... and T7 kits (Ambion #AM1344), according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... An AEC kit (Thermo Fisher) was used as a chromogen and slides were counterstained with Gills 2 hematoxylin (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... with UNG kit (4440038, ThermoFisher) were used for Quantitative PCR assays.
-
bioRxiv - Plant Biology 2022Quote: ... Mini Kit (Thermo Fisher, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... normalized (SequalPrep kit #1051001, Invitrogen), and submitted for sequencing to the DNASU core facility at Arizona State University ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the mMachine mMessage kit (Invitrogen) was used with minor modifications ...
-
bioRxiv - Cell Biology 2022Quote: mMessage machine kit (Invitrogen, AM1348) and RNAeasy purification columns (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: ... The Superscript III kit (Invitrogen) was used to produce the cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... A DNase kit (Invitrogen, CA) was used for RNA purification ...
-
bioRxiv - Genomics 2022Quote: Qubit RNA Assay Kit (ThermoFisher)
-
bioRxiv - Plant Biology 2021Quote: ... Assay Kit (Invitrogen, Paisley, UK).
-
bioRxiv - Molecular Biology 2020Quote: ... The Magnify ChIP kit (ThermoFisher) was used according to manufacturer’s instructions and as described previously (46 ...
-
bioRxiv - Neuroscience 2020Quote: ... and a cDNA kit (ThermoFisher). Primers for qPCR were ATTTTCGGCTCATTCTTCACACT (forward ...
-
bioRxiv - Immunology 2022Quote: ... purified (Megaclear RNA kit, Ambion) and analyzed on Experion (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... and TURBO DNA kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... the Superscript II kit (Invitrogen) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... Qubit protein assay kit (Invitrogen) was used to obtain protein concentration ...
-
bioRxiv - Microbiology 2019Quote: ... using the MICROBEnrich kit (Ambion) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Commercially available kits from ThermoFisher (t-tau ...
-
bioRxiv - Molecular Biology 2019Quote: ... using MaxiScriptT7 kit (Invitrogen, AM1320). Purified m6A-containing products were serially diluted in non-m6A containing products.
-
bioRxiv - Biophysics 2020Quote: ... The mMessage mMachine kit (Ambion) was used to make mRNA as per the manufacturer’s protocol and cleanup using RNAeasy kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Neon Transfection Kit (Invitrogen) was used to transfect cells with CRISPR-mCherry (mCh ...
-
bioRxiv - Immunology 2020Quote: ... using Uncoated ELISA Kits (Invitrogen) for TNF-α ...
-
bioRxiv - Genomics 2019Quote: ... RNaqueous kit from Ambion (#AM1912); Torin 1 from Tocris (#4247) ...
-
bioRxiv - Microbiology 2019Quote: ... The Ribominus kit (Life Technologies) was used to remove rRNA from total RNA ...
-
bioRxiv - Plant Biology 2021Quote: ... Assay Kit (Invitrogen, Paisley, UK).
-
bioRxiv - Biochemistry 2021Quote: ... or MEGAscript T3 kit (Invitrogen) with α-32P UTP ...
-
bioRxiv - Biochemistry 2021Quote: ... The Superscript IV kit (Invitrogen) was used to synthesize cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Aqua LIVE/DEAD kit (Invitrogen) was used to exclude dead cells ...
-
bioRxiv - Cell Biology 2021Quote: ... BacMam 2.0 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... The MegaScript T7 kit (Ambion) was then used to perform in vitro-transcription ...
-
bioRxiv - Developmental Biology 2020Quote: ... MEGAscript RNAi Kit (Thermo Fisher) was used to generate dsRNA to target exon 5-8 of Nvtra mRNA in 4th larval instar females which resulted in a male splice form of NvDsx as shown in Verhulst et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... with MEGAscript T3 kit (Ambion). sgRNA (50 pg each ...
-
bioRxiv - Developmental Biology 2021Quote: ... The Superscript III kit (Invitrogen) was used to synthesize cDNA for qPCR using random hexamer primers ...
-
bioRxiv - Genetics 2021Quote: ... Turbo DNA-free kit (Ambion) was used to eliminate genomic DNA from the samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the RiboPure kit (Ambion) followed by DNase treatment (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... TURBO DNA-free kit (Thermofisher) was used to remove DNA and the RNeasy MinElute Cleanup kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: The MEGAshortscript kit (Life Technologies) and pTRI-β-actin-human template (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... A FoxP3 staining kit (Invitrogen) was used for staining CTLA4 ...
-
bioRxiv - Immunology 2020Quote: ... or miRVana isolation kit (Ambion). RNA quality was checked at Bioanalyser before library preparation ...
-
bioRxiv - Developmental Biology 2021Quote: DNAzol® Reagent kit (Invitrogen Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... NucAwayTM Spin column kit (Ambion) was used to remove unlabeled free nucleotides based on the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... a PureLink RNA kit (Invitrogen) or a Quick-RNA kit (Zymo Research) ...
-
bioRxiv - Cell Biology 2022Quote: ... SP6 mMessage mMachine Kit (Ambion) was used and mRNAs were injected via glass capillaries (30-0020 ...
-
bioRxiv - Microbiology 2022Quote: ... using the Generacer kit (Invitrogen) and specific RACE primers for bfrG and cruR according to the manufacturer’s instructions ...