Labshake search
Citations for Thermo Fisher :
551 - 600 of 9147 citations for Alpinone 3 Acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Developmental Biology 2020Quote: ... were used with Tris-Acetate SDS Running Buffer (pH 8.24) and the HiMark Pre-Stained Protein Standard (Invitrogen, LC5699). Wet transfer on a PVDF membrane was done overnight at 4 mA ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The pellet was resuspended in cold tagmentation buffer (33 mM Tris-acetate (pH = 7.8) (BP-152, Thermo Fisher Scientific), 66 mM K-acetate (P5708 ...
-
bioRxiv - Genomics 2020Quote: ... The pellet was resuspended in cold tagmentation buffer (33 mM Tris-acetate (pH = 7.8) (BP-152, Thermo Fisher Scientific), 66 mM K-acetate (P5708 ...
-
bioRxiv - Molecular Biology 2021Quote: ... PolyA RNA was ethanol precipitated with 2.5 M Ammonium Acetate and 70% ethanol in a solution containing 50 μg/ml GlycoBlue Co-precipitant (AM9515, Invitrogen). RNA was resuspended in 10 μl and fragmented with 10x Fragmentation Buffer (AM8740 ...
-
bioRxiv - Cell Biology 2020Quote: ... and run in pre-chilled 1X MOPS Buffer (Thermo, NP0001) or NuPage Tris-Acetate SDS running buffer (Invitrogen LA0041). Samples were typically run at 100 Volts for 90 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was recovered by precipitation with isopropanol in presence of 0.3 M sodium acetate pH 5.5 and 20 μg Glycoblue (Thermo Scientific). Recovered RNA was dephosphorylated with T4 PNK (NEB ...
-
bioRxiv - Biophysics 2022Quote: ... all samples were immediately buffer exchanged into an nMS-compatible solution (150 mM ammonium acetate, pH 7.5, 0.01% Tween-20) with a 40 kDa MWCO (ThermoFisher Scientific). For nMS analysis ...
-
bioRxiv - Molecular Biology 2020Quote: Purified PDX complexes at 0.2-0.4 mg/mL concentrations (10 µL each in 1xTBS with 4 mM DTT) were buffer exchanged into 200 mM ammonium acetate (pH 6.7) using Zeba 75 µL microspin columns from Thermofisher. Proteins were then loaded into pulled glass capillaries (GlassTip™ ...
-
bioRxiv - Molecular Biology 2020Quote: The total volume of extracted DNA was precipitated with 1/10th volume of 3M sodium acetate (Invitrogen, Carlsbad, California) and double volume of chilled molecular biology grade ethanol (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25% Acetonitrile in Water (Triethylammonium Acetate TEAA – 1.0M, Sigma-Aldrich, Acetonitrile – HPLC Grade, Fisher Chemical, EDTA – 0.5M, pH 8.0, Thermo Scientific). The column was equilibrated with 40% Buffer B ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ultrathin sections were stained with uranyl acetate and lead citrate and analysed with a Tecnai Spirit (Thermo Fisher Scientific) operated at 120 kV.
-
bioRxiv - Neuroscience 2024Quote: ... Solutions were then successively filtered using 0.45 and 0.20 µm cellulose acetate syringe filters (Invitrogen, 171-0020 & 171-0045). CA1 PNs were then electroporated as previously described20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA libraries in the flowthrough were precipitated at −20°C for 18 hours in ethanol with 0.3 M sodium acetate and 1 μl linear acrylamide (AM9520, Ambion). Purified libraries were further quantified and inspected on an Agilent 4200 TapeStation (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... K18 tau and αSyn fibrils were diluted to 2.5-10 µM in 5 mM acetate buffer (Fisher Scientific, Switzerland) at pH 4.5 and coupled for 750 s at a flow rate of 5 µL/min on all surfaces except for ZD150D ...
-
bioRxiv - Zoology 2023Quote: ... The remaining cirDNA was precipitated by ethanol-acetate and then the concentration was determined by Qubit Fluorometer (Invitrogen, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the RNA extracted using the TRIzol method was further purified using the ammonium acetate precipitation method (Ambion, Catalog: AM9070G). The quality of RNA was assessed using Tapestation from Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gels were run at 150 V for 2h in 1× NuPAGE Tris-Acetate SDS Running Buffer (Thermo Fisher Scientific). Protein was transferred onto a PVDF membrane (Merck ...
-
bioRxiv - Biochemistry 2023Quote: ... sample was buffer exchanged into 100 mM ammonium acetate using ZebaTM spin column (7 kDa MWCO, Thermo Fisher Scientific). Sample was loaded into Au/Pd-coated borosilicate emitters (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Electroporation solutions were filtered with 0.45 µm and 0.20 µm filters (Nalgene Syringe Filters, Cellulose Acetate, 4 mm, Thermo Scientific) before loading into the glass pipettes ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatants were passed through a 0.22-μm cellulose acetate filter (Thermo Fisher Scientific catalog number F2517-1) by centrifugation at 6,700 × g for 10 min at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pellet was resuspended in 25µL ice-cold Tagmentation Buffer [33 mM Tris-acetate (pH = 7.8) (Thermo Fisher Scientific), 66 mM K-acetate (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was cooled to 4°C and was transferred to a low bind Eppendorf tube and 0.1 vol 3M Sodium Acetate pH 5.5 (Invitrogen, #AM9740) and 1μL 20mg/mL glycogen (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... according to the manufacturer’s protocol followed by a precipitation step with 1 volume of 5M ammonium acetate (Invitrogen, AM9070G) and 2.5 volumes of 100% ethanol ...
-
bioRxiv - Biophysics 2024Quote: The RNAP samples were buffer-exchanged into nMS solution (500 mM ammonium acetate, pH 7.5, 0.01% Tween-20) using Zeba microspin desalting columns (Thermo Scientific) with a 40-kDa MWCO 73 ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% FBS (Gibco) and 100 U/mL penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved-caspase-3 (9H19L2-Invitrogen); TH (AB152-Merck Millipore) ...