Labshake search
Citations for Thermo Fisher :
501 - 550 of 9147 citations for Alpinone 3 Acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Plant Biology 2020Quote: ... reinhardtii strains WT-SAG and CRISPRXylT1A_1 were grown axenically in tris-acetate-phosphate (TAP) medium (Thermo Fisher Scientific) in a Memmert IPP 100Plus incubator on a 12h day / 12h night cycle ...
-
bioRxiv - Biochemistry 2021Quote: ... Flowthrough was then collected after spinning the suspension down in a cellulose acetate spin column (Thermo Scientific #69702), separating the His-tagged UBA1 from the other components ...
-
bioRxiv - Microbiology 2021Quote: ... Corning™ Accutase™ detachment solution and phorbol 12-myristate 13-acetate (PMA) were obtained from Fisher Scientific (cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... run at 150 V for 90 minutes in 1× NuPAGE Tris-Acetate SDS Running Buffer (Thermo Fisher Scientific). Proteins were electrotransferred onto an Immobilon-fl polyvinylidene difluoride (PVDF ...
-
bioRxiv - Genetics 2020Quote: ... reduced whole cell lysates were electrophoresed on a NuPAGE 7% Tris-Acetate pre-cast 1.0 mm gels (Invitrogen) for 50 minutes at 150 V and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mobile phase consisted of buffer A: 5 mM ammonium acetate in water (LC/MS grade, Thermo Scientific) and buffer B ...
-
bioRxiv - Microbiology 2023Quote: ... Acetate and lactate were measured using an ICS-1100 series ion chromatograph (Thermo Fisher Scientific, Waltham, MA, USA) equipped with a polysulfonate ion-exclusion column (Metrosep A Supp 5) ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA was precipitated with 2.5x volumes ice-cold ethanol and 0.1x volume 3M sodium acetate pH 5.5 (ThermoFisher #AM9740) overnight at -80°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The mobile phase consisted of buffer A: 5 mM ammonium acetate in water (LC-MS grade, Thermo Scientific) and buffer B ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was purified via ethanol precipitation (final concentrations of 0.3 M sodium acetate pH 5.2, 0.3 µg/mL glycoblue (Invitrogen #AM9516), and 70% ethanol ...
-
bioRxiv - Microbiology 2024Quote: ... THP-1 were differentiated by the addition of 150ng/mL phorbol 12-myristate 13-acetate (PMA) (ThermoFisher Scientific). The epithelial cell lines were cultured according to ATCC guidance for the specific cell line and as adherent cells ...
-
bioRxiv - Cell Biology 2024Quote: ... Five μL of each sample were loaded per lane on a 4-12% Tris-acetate gel (Invitrogen XP04125BOX), and proteins were transferred to a 0.2 μm nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... Corning™ Accutase™ detachment solution and phorbol 12-myristate 13-acetate (PMA) were obtained from Fisher Scientific (cat ...
-
bioRxiv - Biochemistry 2024Quote: ... total RNA extraction was carried out using acetate-saturated phenol/CHCl3 at pH 4.5 (Thermo Fisher Scientific, AM9720). The isolated RNA was then resuspended in 10 mM NaOAc/HOAc at pH 4.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were buffer exchanged into 500 mM ammonium acetate using Zeba Spin 7K MWCO desalting columns (ThermoFisher Scientific). Samples were analysed by nanoelectrospray ionisation MS using a quadrupole-orbitrap MS (Q-Exactive UHMR ...
-
Droplet microfluidic screening to engineer angiotensin-converting enzyme 2 (ACE2) catalytic activitybioRxiv - Bioengineering 2024Quote: ... Undeveloped photoresist was washed off with SU-8 developer (1-methoxy-2-propanol acetate, Fisher Scientific, Waltham, MA).
-
bioRxiv - Cancer Biology 2024Quote: ... The mobile phase consisted of buffer A: 5 mM ammonium acetate in water (LC/MS grade, Thermo Scientific) and buffer B ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Cell Biology 2024Quote: ... QuantStudio 3 (Thermo Fisher) was used for quantification using a standard curve method.
-
bioRxiv - Microbiology 2024Quote: ... and 3% _-glutamine (Gibco). Madin-Darby canine kidney (MDCK ...
-
bioRxiv - Microbiology 2024Quote: ... or TOPO-3 (Invitrogen) for 10 mins ...
-
bioRxiv - Microbiology 2024Quote: DiOC2(3) (Thermo Scientific) exhibits green fluorescence in all bacterial cells at low concentrations ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 % B27 (Gibco, 17504044), 0.1 % Glutamax ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-3-PGK (Invitrogen) was used at a 1:8000 dilution ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...