Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... with 5% FCS (Gibco), MEM only ...
-
bioRxiv - Neuroscience 2023Quote: ... and penicillin/streptomycin (GIBCO)] and 5% FBS (GIBCO). After 2 hours incubation ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% FBS (Gibco, #A3160802) and 1% penicillin/ streptomycin (pen/ strep ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% horse serum (Invitrogen), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 (ThermoFisher), 20mM Tris-HCl pH 7.8 (ThermoFisher) ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5% Penicillin/Streptomycin (Gibco) and 2.5 mM L-Glutamine at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% EDTA (Invitrogen) route in accordance with IACUC guidance ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). Lysis of the cells was performed using RLT lysis buffer (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). After 72h stimulation ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5% goat serum (Gibco), and 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% FBS (Gibco) and 1% glutamine ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% mouse serum (Invitrogen) and 5% rat serum (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured in non-gelatinized culture flasks at 37°C in alpha minimal essential media with 20% heat inactivated FBS and 1% Penicillin/Streptomycin (Life Technologies, 100 U ml−1). Prior to in vitro NK cell differentiation ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then incubated in 500 μL of primary antibody solution containing rat anti-alpha-tubulin YL1/2 (MA1-80017, Invitrogen, CA, SAD, diluted 1:500) overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then incubated in 500 μL of primary antibody solution containing rat anti-alpha-tubulin YL1/2 (MA1-80017, Invitrogen, CA, SAD, diluted 1:500) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by sonication three times for 5 seconds with 5 seconds intervals at #5 (on dial) (Fisher Scientific 60 Sonic Dismembrator) on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were cultured at 37 °C in a humidified incubator at 21% oxygen/5% CO2 or 5% O2/5% CO2 (HeraCell Tri-Gas, ThermoFisher Inc).
-
bioRxiv - Immunology 2020Quote: ... BRET signal was read after 5 min of coelenterazine-h (5 μM, Invitrogen) addition ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 5 μg/ml Hoechst 33342 and 5 µM CellRox Deep Red (Invitrogen) and/or MitoSox Red (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: - Falcon round-bottom polystyrene tubes 5 mL (Cat# 14-959-5, Fisher Scientific)
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2023Quote: ... 5-fluorocytosine (100 mg/kg/d; diluted in sterile saline; 5-FC; ThermoFisher) was used in combination with PEA (0.5 mg/kg/d ...
-
bioRxiv - Immunology 2023Quote: ... 5x10-5 M 2-mercaptoethanol (2-ME) and 5 mM HEPES (all Invitrogen).
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 5% fetal calf serum and 5% newborn calf serum (both GIBCO) and antibiotics (#A5955 ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 5% fetal calf serum and 5% newborn calf serum (both GIBCO), and antibiotics (#A5955 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.6 μL of 5 μM TaqMan probe (5’-FAM-CAAGAGGTGGACGGCC-MGB) (ThermoFisher Scientific) and 0.1 μL of nuclease free water ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 μm 0.3 x 5 mm nano trap column (Thermo Fisher Scientific,UK) and an Aurora ultimate TS 75 μm x 25 cm x 1.7 μm C18 column (IonOpticks) ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Molecular Biology 2022Quote: ... pLV-mCherry at ratio 1:1:1 (i.e. 5:5:5 μg) using Lipofectamin™ 3000 transfection reagent (Thermo-Fisher Scientific, #L3000015). Pseudoviruses harvested from the supernatant at 48 h 72h post-transfection were filtered (0.44 μm ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2023Quote: ... Leukocytes were washed with cold PBS followed by another centrifugation step (300 x g 5 minutes) and resuspended in 5 mL of 5 μg mL-1 of Hoechst 33342 (Thermo Fisher Scientific) diluted in warm PBS ...
-
bioRxiv - Pathology 2023Quote: ... one lung section 5×5×5 mm in size was finely cut and stored at -20°C in RNAlater (Thermo Scientific, US). We mechanically disrupted the tissue from RNAlater using a MediMachine (BD Biosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was subjected to 5’ adapter ligation with a 5’ chimeric DNA-RNA adapter (5’aminolinker-GTTCAGAGTTCTACAGTCCGACGATCrNrNrNrN) using RNA ligase (EL0021, Thermo Fisher Scientific) at 37°C for 1 hour ...
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...