Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µL of 5% ammonium persulfate (APS) (Thermo Scientific, 17874). 50 µl was added to a strip of parafilm in a humidity chamber on ice ...
-
bioRxiv - Biophysics 2023Quote: ... samples were incubated with a 5 μM DRAQ-5 (Thermo Scientific) DNA staining buffer at 37° C for 30 minutes with agitation ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.3 × 5 mm trapping column (5 µm, 100 Å, Thermo Scientific) and analyzed by nanoLC-ESI-MS/MS analysis using a Thermo Ultimate 3000 RSLC nanoUPLC coupled online to an Orbitrap Exploris™ 240 mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... containing 5 unit/mL penicillin and 5 ug/mL streptomycin (Gibco).
-
bioRxiv - Cell Biology 2020Quote: ... Western blotting was used to confirm reconstituted-protein expression and knockdown efficiency of the generated cell lines using anti-alpha-adaptin (Thermo Fisher Scientific, #AC1-M11) and anti-CALM (Abcam ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tgfβ-3(Cat# Mm00436960) alpha-SMA (Cat# Mm00725412) and Vegf (Cat# Mm00437306_m1) Single Tube TaqMan® Gene Expression Assays (Life Technologies Thermo Fisher Scientific) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Alexa Fluor 488 at 1:500 (A21121) and alpha-bungarotoxin (BTX)- conjugated to Alexa Fluor 594 at 1:1000 (B13423) from Molecular Probes (Eugene, OR, USA). Tissues were mounted on microscope slides using Millipore mounting fluid (Burlington ...
-
bioRxiv - Bioengineering 2020Quote: ... (primary Rabbit anti-mouse alpha-SMA antibody; Cat. No. ab5694; Abcam; 1:50 dilution; secondary Goat anti-rabbit antibody; Cat. No. A11008; Life Technologies; 1:150 dilution). Fluorescent images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Genomics 2021Quote: ... The membranes were incubated overnight with UCP1 antibody and loading control protein alpha tubulin antibody for the total protein adipose tissue samples (1:1.000 UCP1 Polyclonal Antibody, cat no. PA1-24894, 1:500 alpha Tubulin Polyclonal Antibody, cat no. PA5-16891, Invitrogen, Thermo Fisher Scientific, Rockford, USA). Membranes with liver and muscle mitochondrial protein samples were incubated overnight with COX4 antibody (1:1.000 COX4 Polyclonal Antibody ...
-
bioRxiv - Physiology 2021Quote: ... transferred and blotted with Peroxisome proliferator-activated receptor alpha (PPARα, ab 215270), endothelial nitric oxide synthase (eNOS, sc-376751) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Thermo Fisher, #10941-1-AP) antibodies as described [65] ...
-
bioRxiv - Cell Biology 2022Quote: ... or embryonic stem cell-derived fibroblasts as in (40, 41) were cultured in complete medium consisting of Minimum Essential Media alpha (MEMα) with GlutaMa™ (Gibco, catalog no. 32561) and 1% Penicillin/Streptomycin (P/S ...
-
bioRxiv - Cell Biology 2022Quote: The mouse hepatocyte cell line alpha mouse liver 12 (AML12; CRL-2254, ATCC, Manassas, VA) were cultured in DMEM/F12 (11320033, Thermo Fisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (16140071 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Bone marrow was flushed out of femur and tibia and cultured over-night in alpha-minimum essential medium (α-MEM, Gibco; cat#41061-029)containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATTO 550+ cells were sorted by flow cytometry and the 3% most positive cells were seeded at 1 cell per well in alpha minimal essential medium (αMEM, Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... Membranes were washed again and then incubated with SuperSignal West Pico substrate (HA and alpha actinin-1 blots) (Thermo Fisher Scientific, Waltham, MA, #34580) or Supersignal West Femto substrate (FLAG blots ...
-
bioRxiv - Biophysics 2023Quote: ... Total tubulin was labeled using a primary antibody against alpha-tubulin and a Cy3-tagged secondary antibody (Thermo Fisher Scientific Inc., Waltham, MA, USA).
-
bioRxiv - Biophysics 2022Quote: The GyrA14-E487C and the CcdA50-72 peptide (Table S1) were labeled with Fluorescein-5-Maleimide and 5-TAMRA (Tetramethylrhodamine-5-Maleimide) from ThermoFisher Scientific as per the manufacturer’s protocol as described previously (Aghera et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... was amplified by the primers (5’-CACCATATTAATGTTTCGATCATCAGAATC-3’ and 5’-TTCGATAGTGTTGGATTATATAGGG-3’) and cloned into the pENTR 5’-TOPO (Invitrogen) (51) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of PAA premixes with 5% streptavidin–acrylamide (ThermoFisher, Cat#S21379) of the defined rigidity 48 were promptly sandwiched between the activated dish and the micropatterned coverglass immediately after adding a curing catalyst (aminopropyltriethoxysilane (APS)) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM MgCl2 and 5 or 10 mM caged ATP (#A1048 Invitrogen) prior to membrane wrapping ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Immunology 2023Quote: ... mice were injected with 5 μg FK506 (Invitrogen Cat. #INH-FK5-5). Thymi were taken for flow cytometry 24 or 48h after FK506 was administered ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Biophysics 2024Quote: ... The PepMap100 C18 (5 μm 0.3 x 5 mm, Thermo Fisher Scientific) and the ACQUITY BEH C18 (1.7 µm 1.0 × 100 mm ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 μl/IP anti-GFP (A-11122, ThermoFisher, 5 ul/IP), for 3 hours at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured in non-gelatinized culture flasks at 37°C in alpha minimal essential media with 20% heat inactivated FBS and 1% Penicillin/Streptomycin (Life Technologies, 100 U ml−1). Prior to in vitro NK cell differentiation ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then incubated in 500 μL of primary antibody solution containing rat anti-alpha-tubulin YL1/2 (MA1-80017, Invitrogen, CA, SAD, diluted 1:500) overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then incubated in 500 μL of primary antibody solution containing rat anti-alpha-tubulin YL1/2 (MA1-80017, Invitrogen, CA, SAD, diluted 1:500) overnight at 4 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... 5-fluorouracil (Fisher Scientific), 5-fluoroorotic acid (Fisher Scientific) ...
-
bioRxiv - Biophysics 2021Quote: ... 5 mM HEPES (Gibco), 0.1% BSA (Abcone ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 % sodium bicarbonate (GIBCO), 1 % penicillin/streptomycin (P/S ...
-
bioRxiv - Microbiology 2021Quote: ... 5% HEPES buffer (Gibco) and 57% Distilled water (Versol) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 % horse serum (Gibco), 1 mM glutamine (Gibco) ...
-
bioRxiv - Genetics 2020Quote: ... 5% FBS (ThermoFisher, UK), Amphotericin B 250 μg/ml (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM HEPES (Gibco), 2% Triton X-100 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM HEPES (Gibco)) was added and tissue was bead beat for 1 min ...
-
bioRxiv - Neuroscience 2020Quote: ... 5% horse serum (Gibco), 1x GlutaMax (Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mL Trizol (Invitrogen) was added to thawed pellets on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% Brij98 (ACROS Organics), 5% Lubrol WX (MP Biomedicals) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA (Gibco), 0.1 % SDS (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 5% FBS (Gibco) and 50 µg/mL penicillin/streptomycin (P/S) ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5% FBS (Gibco 26140) + 5% HS (Gibco 16050 ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5% HS (Gibco 16050) + 1% PS (Gibco 15140)] and placed in a humidified incubator (5% CO2 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μm (Thermo Scientific) C18 trapping cartridge ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-claudin 5 (Thermofisher), anti-laminin (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 5 mM DTT (Invitrogen), 6 mM MgCl2 (Ambion) ...
-
bioRxiv - Microbiology 2020Quote: 5’ RACE (Life Technologies) was performed on mRNA prepared from SBW25 cells grown overnight in M9 media with pyruvate (0.4% w/v ...