Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 4 3 2 Chloroethyl 3 nitrosoureido tetrahydro 2H thiopyran 1 1 dioxide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 µL of tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) to 30 µL of sample ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Biophysics 2023Quote: ... 3 µL of 2% 0.2 µm carboxylated FluoSpheres (Invitrogen, Carlsbad, CA), 20 µL of 20 mM Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were loaded with 3 µM of Fura-2 AM (Invitrogen) in extracellular solution (ECS ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 and 3 using the EVOS XL core microscope (Life Technologies).
-
bioRxiv - Biophysics 2024Quote: ... We passaged cells every 2–3 days using Accutase (Thermo Fisher).
-
bioRxiv - Physiology 2020Quote: ... muscles were stained for 3 minutes with 10μM 4-(4-diethylaminostyrl)-N-methylpyridinium iodide (4-Di-2ASP, Molecular Probes) to allow imaging muscle with an upright epifluorescence microscope (Leica DMR ...
-
bioRxiv - Neuroscience 2022Quote: ... We incubated overnight with the anti-GFP primary antibody at 4 degrees (1:1000, A-6455 Invitrogen, 0.1M PBS 0.3% tx100, 3% NGS). After abundant PBS washes ...
-
bioRxiv - Genomics 2022Quote: ... Plasmids were mixed in a 3:1 weight ratio of total plasmid DNA:PEI in 4 mL of either OptiMeM™ (Gibco cat. # 31985-062) or serum-free DMEM per flask and then shaken vigorously for 30 sec ...
-
bioRxiv - Cell Biology 2023Quote: ... and lentiviral vector expressing GFP-UMOD-WT or GFP-UMOD-H177- R185 del at a ratio of 3:1:4 using Lipofectamine 3000 Reagent (ThermoFisher Scientific, Waltham, MA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed 3 times with 200 µL PBS for 4 min before secondary antibodies and 1 µg/mL Hoechst (Thermo Fisher Scientific #33342) were added in 35 µL per well and incubated for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... protein fractions were mixed with SDS-free loading buffer in a 3:1 ratio and loaded on a Novex™ 4–20% Tris-Glycine Gels using NativeMark™ Unstained Protein Standards (Invitrogen™) (range from 20 to 1236 kDa ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the packaging plasmids psPAX2 and pMD2.G at a ratio 4:3:1 in the presence of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The supernatants containing lentiviral particles were collected 48 hours after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were incubated at room-temperature for 3-4 hours with secondary antibody mixture containing Alexa Fluor 568 anti-mouse (1:500; Thermo Fisher Scientific, A11031) and Alexa Fluor 647 anti-chicken (1:500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Drug dilution series (1:3) were prepared in PDAC organoid culture medium containing 1 μg/ml Hoechst (Invitrogen) and 1 μg/ml PI (Sigma) ...
-
bioRxiv - Physiology 2022Quote: ... Plasmid DNA was mixed with PEI (1 mg/ml) at 1:3 in Opti-MEM medium (Gibco, 11058021) and added to cells after short incubation ...
-
bioRxiv - Genetics 2022Quote: Calu-3 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM)/F12 (1:1) GlutaMAX™ (ThermoFisher Scientific) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... were added to the tumoroids in a 1:3 and 1:10 effector:target (E:T) ratio in RPMI 1640 (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... stained with TO-PRO-3 diluted 1:1000 in DPBS and 1 µM Hoechst 33342 (Thermo Fisher 62249) nuclear counterstain for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 3 μg mRNA at a mass ratio of 1:1 using Lipofectamine MessengerMAX (Invitrogen) according to the manufacturer’s guide ...
-
bioRxiv - Cell Biology 2020Quote: ... and TagRFP-T-VAPB(1-218)-eMagB or TagRFP-T-eMagB-PHOSBP (prey) and iRFP-P4C at a 3:2:1 ratio in OptiMEM-I (Thermo Fisher Scientific) (1:4 DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY™ FL C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine (PED-A1) and BODIPY™ FL C5 were purchased from Thermofisher scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... washed 3 times with blocking buffer and incubated for 2 h with Alexa 647 anti-rabbit (1/250, A21247, Thermo Fisher Scientific). After washing the cells 3 times with PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... approximately 1 pmol injected onto a Acclaim PepMap 100 guard column (75 μm×2 cm C18, 3 μm particles, 100 Å; Thermo Scientific) and separated on a 50 cm PepMap RSLC C18 (75 μm×50 cm ...
-
bioRxiv - Microbiology 2020Quote: ... incubating with primary antibodies (rabbit anti-β-actin, 1:1000, Thermo Fisher Scientific, PA1-183; mouse anti-claudin-2, 3:500, Invitrogen, 325600 ...
-
bioRxiv - Microbiology 2020Quote: ... were performed on an Ultimate 3000 RSLC nano instrument coupled to either a QExactive Plus (M#1, M#3) or an HF mass spectrometer (M#2; Thermo Fisher Scientific) as described previously.24 Tryptic peptides were trapped for 4 min on an Acclaim Pep Map 100 column (2 cm × 75 μm ...
-
bioRxiv - Neuroscience 2024Quote: ... cochleae were plated in six-well plates (2-3 explants/well) containing 1 ml media (growth medium DMEM (12430-054,Gibco Life Technologies) combined with 1% FBS (16000-044 ...
-
bioRxiv - Physiology 2024Quote: ... Samples were washed 3 times with 0.025% PBS-Tween20 and incubated with Alexa-conjugated secondary antibodies listed in Supplemental Table 2 (Life Technologies, 1/1000e) for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were first loaded for 3 min onto the Acclaim PepMap 100 C18 trap column (75 µm x 2 cm, 3 µm material, Thermo Scientific) with 5 µL min-1 of 3.2% (v/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: HeLa cell pellets (∼2×107) or MCF7 cell pellets (∼4×107) were lysed with 3 mL Mammalian Protein Extraction Reagent (Thermo Scientific), supplemented with 2X HALT protease inhibitor (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... 3-4 mg total protein and 2 ug of KIF1C antibody or 10 ug mCherry antibody (Invitrogen mCherry Monoclonal Antibody (16D7)) were used ...
-
The effects of caloric restriction on adipose tissue and metabolic health are sex- and age-dependentbioRxiv - Physiology 2023Quote: ... Tissues in formalin were fixed at 4°C for 2-3 days before being washed and stored in DPBS (Life Technologies). Tissues on dry ice were stored at −80°C prior to downstream analysis.
-
bioRxiv - Immunology 2024Quote: ... the reaction mixture was dialyzed against deionized water at 4 °C for 2 days using Slide-A-LyzerTM Dialysis Cassette (10K MWCO, 3 mL, Thermo Scientific) and stored at −70 °C.
-
bioRxiv - Systems Biology 2024Quote: ... and incubated in total of 150 µL SH2 binding buffer containing 20 µM biotinylated SH2 domain on a rotator and 4 °C for 2-3 hours in low protein binding microcentrifuge tubes (1.5 mL, Thermo Scientific™). The functionalized magnetic beads are then washed twice in 1 mL of SH2 binding buffer ...
-
bioRxiv - Bioengineering 2024Quote: Samples were washed 3 times with DPBS before being incubated with secondary antibodies and 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, 10125092) at 1:500 in the blocking solution ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineeethanesulfonci acid (HEPES; Thermo Fisher), and 1X non-essential amino acids (Gibco ...
-
bioRxiv - Pathology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies, 1:250) to reveal actin and the nucleus ...
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...