Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 2' 3' Dimethyl 3 2 5 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... with 10µM 5-Bromo-2’-Deoxyuridine (Invitrogen) being added for the last 6 h of treatments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-ethynyl-2-de-oxyuridine (EdU; ThermoFisher) was provided via intracardiac intravenous injection for chick embryos (E4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5-etinil-2’-desoxiuridina (EdU; A10044, ThermoFisher) is a small thymidine analogue that can be detected using click chemistry ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5mM EdU (5-ethynyl 2’-deoxyuridine, Invitrogen), 0.5mM EC (5-ethynyl cytidine ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 days after transfection by 5 µl of lipofectamine 2000 (Invitrogen) with 2 µg of the plasmid and regularly re-sorted to maintain expression of myr/palm-mCherry.
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Cell Biology 2024Quote: ... The siRNA oligonucleotide targeting RIF1 sequence (Invitrogen; Sense: 5’-GAAUGAGCCCCUAGGGAAATT-3’) 138 was used ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™ ...
-
bioRxiv - Bioengineering 2021Quote: ... Medium was changed every 2-3 days and cell passages were carried out using a TrypLE Express solution (Gibco). Human TERT-immortalized gingival fibroblasts (hTERT-HGF ...
-
bioRxiv - Neuroscience 2020Quote: ... pooled and purified cDNA libraries with mean sizes of 550-600 bp and concentrations of 2-3 ng/µl (measured with Qubit 2.0, Invitrogen) were sequenced on a HiSeq 2500 Illumina system with single-end 50 bp read lengths ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 3 (100 pmol for each) or control siRNA were transfected into HeLa cells using Lipofectamine 2000 (Invitrogen). 48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... After incubation for 2 h at 37°C the medium was aspirated and 3 mL of fresh DMEM (Gibco) supplemented with 5% New Born Calf Serum (NBCS ...
-
bioRxiv - Microbiology 2021Quote: ... The other half of the wells of the Caco-2 cells was subsequently incubated anaerobically for 3 h with 0.3% gentamicin (50 μg/ml, Gibco) to eliminate all extracellular L ...
-
bioRxiv - Microbiology 2021Quote: ... The other half of the wells of the Caco-2 cells was subsequently incubated anaerobically for 3 h with 0.3% gentamicin (50 µg/ml, Gibco) to eliminate all extracellular L ...
-
bioRxiv - Cell Biology 2021Quote: ... under 5% CO2 at 37°C in humidifying conditions and passaged every 2-3 days using 0.25% Trypsin-EDTA (25200056, Gibco). Cells were routinely tested for mycoplasma ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™ ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 3 µg of RNA was DNAse treated using 2 units of Turbo DNase I enzyme (Invitrogen). A total of 1 µg of DNAse-treated RNA was reverse transcribed using Superscript III reverse transcriptase (Invitrogen/Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell viability was determined by the MTT [3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Invitrogen, Waltham, MA) reduction assay ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary antibodies were applied for 2 hours in PBS/3% milk powder containing 1 μg/ml Hoechst-33342 (Invitrogen) or DAPI (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... conditioned media was replaced by a 1.2 mM 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Thermo Fisher Scientific) solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per condition were plated in 96 U-shape well plates (CELLSTAR, Kremsmünster) and rested for 2-3 h in RPMI (Gibco), supplemented with 10% FBS ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and cell viability was then determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability assay (Invitrogen, USA) according to the manufacturer’s protocol 28 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The reaction solution was vortexed for 2-3 seconds to avoid bubbles and added to 384-well plate (Nunc™ MicroWell™ 384-Well Optical-Bottom Plates ...
-
bioRxiv - Cell Biology 2020Quote: ... 2×106 NP-TTD were transfected with 3 µg plasmid via electroporation using Neon™ Transfection System (MPK1096, Invitrogen) with following parameters ...