Labshake search
Citations for Thermo Fisher :
5851 - 5900 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The resin was then treated with 5× Lane Marker Reducing Sample Buffer (Thermo Fisher). To generate the Triton X-100-soluble and -insoluble fractions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Guanosine-5-diphosphate (GDP) and unlabeled GTPγS were purchased from Fisher Scientific (Waltham, MA) and Sigma-Aldrich (St ...
-
bioRxiv - Microbiology 2023Quote: ... equal amounts of cDNA and 5 μL of SYBR green master mix (Thermo Scientific). qPCR was performed on a Lightcycler 480 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5–6 trophectodermal cells were biopsied and their ploidy was assessed by Thermo Fisher Scientific’s NGS technology ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... cells were incubated for 5 minutes with CellMask orange (1:40000, Thermo Fisher Scientific) and 5 minutes with SPY650 (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... 5 ug of plasmid DNA were placed in 250 μL OptiMEM media (Gibco, 31985062), then 7.5 μL of transit-LTI reagent was added to DNA/OptiMEM solution ...
-
bioRxiv - Immunology 2023Quote: ... cells were stained with 5 μM of mitoSOX mitochondrial indicator (Thermo Fisher Scientific, #M36008) for 10 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both DsiRNAs against FANCM were mixed with 5 μL Lipofectamine RNAiMAX (ThermoFisher cat #: 13778150) and 500 μL Opti-MEM so that the total final concentration of RNA in media would be 40 nM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cy-2- or Cy-5-conjugated goat anti-mouse secondary antibodies (Thermo Fisher Scientific) were used at a 1:750 dilution in 5% HIGS/PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti6/V5-Flag-USP39 infected cells were selected with 5 μg/ml blasticidin (Gibco) while pLL3.7-shRNA infected cells were selected with 2μg/ml puromycin (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... eBioscience anti-mouse CD4 PE-Cy7 clone: RM4-5 (Ref # 25-0042-82, Invitrogen), PE anti-mouse CD8a (Ly-2)(53-6.7 ...
-
bioRxiv - Genomics 2022Quote: ... groin and gut were taken and streaked on 5% horse blood agar (Thermo Fisher), prior to incubation at 37 °C for 24 hours and final identification of coagulase-negative Staphylococci after sub-culture on mannitol-salt agar (Oxoid ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-Keratin 5 (1:200; clone EP1601Y; MA5-14473; RRID:AB_10979451; Thermo Fisher Scientific), rabbit anti-SFTPC (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Cell Biology 2023Quote: ... centrifuged for 5 mins at 300xg and counted using trypan blue (Thermo Fisher Scientific). 200,000 cells/well were resuspended in E8 containing 10 μM Y27632 ROCK inhibitor (Selleckchem ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was replaced with fresh medium containing 5 μg/ml blasticidin (ThermoFisher Scientific) and the cells were cultured for 10 days ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (ThermoFisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 230C ...
-
bioRxiv - Developmental Biology 2023Quote: 5’-RACE assay was performed using the First Choice RLM-RACE kit (Thermo Scientific) following manufacture’s instruction ...
-
bioRxiv - Biochemistry 2023Quote: Samples (5 µL) were chromatographically separated using an RSLCnano system (Ultimate 3000, Thermo Scientific) coupled online to an Orbitrap Eclipse mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... Oligonucleotide probes were synthesized and labeled with biotin at the 5′ end by Invitrogen. The EMSA was performed using a Chemiluminescent EMSA kit (Beyotime ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... muscles were injected with 5 µM Fluo-4 penta-potassium salt (ThermoFisher Scientific, USA) as previously described and viewed with DIC optics on a Nikon Eclipse TE300 inverted light microscope (400× ...
-
bioRxiv - Genetics 2023Quote: ... 2×10^5 individualized iPSCs were resuspended in 10 μL Resuspension Buffer R (Invitrogen) containing CRISPR ribonucleoproteins (Cas9 nuclease +sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... per 5 x 104 hiPSC-CMs using Lipofectamine 3000 transfection agent (Cat. L3000001, ThermoFisher) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... then they were incubated for 2 h in 5% normal donkey serum (NDS, Gibco), 0.2% Triton-X100 in PBS to block nonspecific binding ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections of 4-5 μm were cut using a rotary microtome (HM355S, Thermo Scientific). Sections were deparaffinized in xylene and rehydrated in a descending series of ethanol (96%–50% ...
-
bioRxiv - Cell Biology 2023Quote: ... centrifuged at 1000 rpm for 5 min and washed with 1X cold PBS (Gibco). The resulting pellet was suspended with 1X Annexin binding buffer (Becton Dickinson) ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were blocked in the blocking buffer – 5% BSA (Thermo Fisher Scientific, #BP9704100) in PBST (PBS with 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... Cultures were incubated (37 °C; 5% CO2) in a medium consisting of MEM (Invitrogen), supplemented with 35 mM Glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% FBS and 1% penicillin-streptomycin (all from Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... and cultured at 37°C and 5% CO2 in RPMI 1640 medium (Life Technologies) supplemented with 10% HIFBS (Gibco) ...
-
bioRxiv - Biochemistry 2023Quote: ... for 24 h or 10 nM of siRNA and 5 µL of RNAiMAX (Invitrogen) for 48 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µl were injected using a Vanquish Horizon UPLC (Thermo Fisher Scientific; Waltham, MA) and compounds were separated on a Zorbax Eclipse Plus C18 guard (2.1 × 50 mm and 1.8 μm particle size ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplification was performed on a QuantStudio™5 Real-Time PCR System (ThermoFisher Scientific) using the following cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... Medium was exchanged on DIV 4-5 for phenol-free Neurobasal medium (Thermo Fisher) supplemented with GlutaMAX 1x (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 5 nM of siRNA using Lipofectamine RNAiMAX Reagent (ThermoFisher Scientific) for 72 hours.
-
bioRxiv - Cancer Biology 2023Quote: ... envelope plasmid pIP/VSV-G (5 µg) (ViraPowerTM Lentiviral Packaging Mix, Thermo Fisher Scientific), 5 µg of lentiviral expression construct shRNA (pLKO.1 Mission shRNA DNA clone ...
-
bioRxiv - Biophysics 2023Quote: ... at 37 °C and 5% CO2 in DMEM medium with L-glutamine (ThermoFisher, 11965092) containing 10% FBS (BI ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... B cells were stained with 5 nM CellTrace™ Violet Cell (C34557, Thermo Fisher) for 8 minutes in 37L°C water bath ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO] ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were maintained in 5% CO2 and DMEM/F12 1:1 media (Gibco; Invitrogen) supplemented with 10% FBS (Cytiva HyClone) ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 µl of template and TaqMan Fast Virus 1-step mastermix (Applied Biosystems). Primer sequences and concentrations and thermal cycling conditions for SARS-CoV-2 nucleocapsid 1 gene were as previously described (13) ...
-
bioRxiv - Microbiology 2023Quote: ... and either the QuantStudio™ 5 or QuantStudio™ Flex 7 analyser (Applied Biosystems). For analysis on viral gene copy numbers ...
-
Per-pixel unmixing of spectrally overlapping fluorophores using intra-exposure excitation modulationbioRxiv - Biophysics 2023Quote: HeLa cells were grown at 37°C in 5% CO2 atmosphere in DMEM (ThermoFisher) with GlutaMAX-1 complemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 × 105 293T cells were seeded into 48-well plates (Thermo Fisher, CA, USA). After 24 hrs ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured at 37 °C and 5 % CO2 on 4-well plates (Nunc) (300 µl/well ...
-
bioRxiv - Immunology 2023Quote: ... Tumor cell lines were cultured at 37°C and 5% CO2 in DMEM (Gibco) supplemented with 10% FBS (Atlanta Biologicals) ...